Supercharge Your Innovation With Domain-Expert AI Agents!

Uridine-cytidine kinase mutant and application thereof in production of cytidine monophosphate

A glycoside kinase and mutant technology, applied in the direction of application, microbial-based methods, biochemical equipment and methods, etc., can solve the problems that the enzyme catalytic efficiency does not reach a high enough level, reduce the enzyme catalytic reaction efficiency, increase the production cycle, etc. , to achieve the effect of promoting application, improving catalytic efficiency and efficient production

Pending Publication Date: 2022-03-01
江苏香地化学有限公司 +1
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the catalytic efficiency of the enzyme has not reached a high enough level, which will reduce the efficiency of the enzyme-catalyzed reaction and increase the production cycle. Through protein engineering, a method for molecular modification of the enzyme protein to improve the catalytic efficiency of the enzyme is very important necessary

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Uridine-cytidine kinase mutant and application thereof in production of cytidine monophosphate
  • Uridine-cytidine kinase mutant and application thereof in production of cytidine monophosphate
  • Uridine-cytidine kinase mutant and application thereof in production of cytidine monophosphate

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1: Preparation of uridine-cytidine kinase wild enzyme and acetate kinase

[0052] Specific steps are as follows:

[0053] (1) In this embodiment, molecular biology methods are used to design primers for PCR amplification of the uridine-cytidine kinase gene udk derived from E. coli (the nucleotide sequence is shown in SEQ ID NO.2, wherein the urine derived from E. Sequence alignment of glycoside-cytidine kinase gene and its tertiary structure homology modeling analysis such as figure 2 shown) and the acetate kinase gene ack (nucleotide sequence shown in SEQ ID NO.4) derived from Lactobacillus bulgaricus were co-expressed using the plasmid pRSFDuet; meanwhile, the uridine-cytidine kinase gene udk was expressed using the plasmid pRSFDuet.

[0054] Specific primers:

[0055] Ec-udk-FW: catgccatgggcactgatcagtctcatcagtg;

[0056] Ec-udk-RS: cgggatccttatcaaagaactgactta;

[0057] Lb-ack-FW:ggaattccatatggacaagattttagcaatcaa;

[0058] Lb-ack-RS: ggggtaccttacttaagctt...

Embodiment 2

[0068] Example 2: Preparation of Uridine-Cytidine Kinase Mutants

[0069] Specific steps are as follows:

[0070] (1) Using the recombinant plasmid pRSFDuet-udk containing the uridine-cytidine kinase gene udk prepared in Example 1 as a template, use primers H100F_FW: cagctatgttgaattcacgcgtatgaaag and H100F_RS: ctttcatacgcgtgaattcaacatagctg to perform PCR amplification to obtain the udk mutant H100F gene The recombinant plasmid pRSFDuet-H100F.

[0071] PCR amplification conditions: pre-denaturation at 98°C, 5min; denaturation at 95°C, 30s; annealing at 55°C, 30s; extension at 72°C, 1min; setting cycle 29 times; extension at 72°C, 10min; final incubation at 16°C. PCR amplification system: 5×PS buffer 20 μL, dNTP 10 μL, upstream / downstream primer (10 μmol·L-1) 2 μL, template 1 μL, enzyme 1 μL, water 66 μL. The recombinant plasmid pRSFDuet-H100F was obtained by PCR, transformed into Escherichia coli JM109, positive clones were obtained by screening on LB plate, and the plasmid w...

Embodiment 3

[0084] Example 3: Catalytic Efficiency of Uridine-Cytidine Kinase Mutants

[0085]The crude enzyme solution containing wild-type udk-ack, the crude enzyme solution containing mutant H100Y-ack, and the crude enzyme solution containing mutant H100F-ack were used to catalyze the production of 5'-cytidylic acid from cytidine, and the uridine- The kinetic parameters of cytidine kinase, the results are shown in Table 2 and Figure 4 shown.

[0086] Table 2 Kinetic parameters of uridine-cytidine kinase and its mutants H100F and H100Y

[0087] parameter kcat(s -1 )

Km (μM) kcat / Km(M -1 the s -1 )

WT 7.3 230 3.2*10 4

H100F 7.2 133 5.5*10 4

H100Y 3.5 91 3.8*10 4

[0088] It has been determined that:

[0089] The kinetic parameters of the wild-type uridine-cytidine kinase were kcat values ​​of 7.3s -1 , Km value is 230μM, kcat / Km value is 3.2*104M -1 ·s -1 .

[0090] Kinetic parameters of the uridine-cytidine kinase mu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a uridine-cytidine kinase mutant and application of the uridine-cytidine kinase mutant in production of cytidine monophosphate, and belongs to the field of enzyme engineering and biological catalysis. The uridine-cytidine kinase is subjected to site-specific mutagenesis by adopting a site-specific mutagenesis technology, the catalytic efficiency of the uridine-cytidine kinase is improved, and the uridine-cytidine kinase is coupled with acetate kinase for catalysis, so that 5 '-cytidine is efficiently catalyzed to produce 5'-cytidine monophosphate, and the 5 '-cytidine monophosphate (5'-CMP) can be efficiently produced. After the uridine-cytidine kinase mutant obtained by the invention is coupled with acetokinase, 5 '-cytidine monophosphate can be efficiently produced, when catalysis is carried out for 2.5 hours, the conversion rate can reach 98%, and the application of the uridine-cytidine kinase mutant in the fields of medicines and the like can be promoted. The efficient uridine-cytidine kinase can be used for realizing industrial production of 5 '-CMP, is beneficial to reducing the production cost and environmental pollution, and realizes green biological manufacturing.

Description

technical field [0001] The invention relates to a uridine-cytidine kinase mutant and its application in the production of cytidylic acid, belonging to the fields of enzyme engineering and biocatalysis. Background technique [0002] Nucleotides are mainly involved in the formation of nucleic acids and have important biological functions. Nucleotides and their derivatives can be widely used in agricultural production, food, medicine and other fields. The chemical synthesis of nucleotides usually uses phosphorus oxychloride as a phosphate donor, and the nucleosides are directly phosphorylated to produce the corresponding nucleotides. However, when this chemical method is used to synthesize 5'-cytidine, it is necessary to add a protecting group to the 2', 3'-hydroxyl of ribose, and then carry out the phosphorylation reaction. The chemical synthesis of nucleotides has many operating steps, long routes, poor stereoselectivity, expensive and toxic reagents, poor operability, and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/12C12N15/54C12N15/70C12N1/21C12P19/30C12R1/19
CPCC12N9/1205C12N15/70C12P19/305Y02P20/55
Inventor 杨海泉张玮琪张飞龙张剑
Owner 江苏香地化学有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com