Ackerman bacteria Amuc2172 protein as well as preparation method and application thereof

A protein and application technology, applied in the field of biomedicine, can solve problems such as intestinal inflammation and poor cancer treatment effect, and achieve the effects of easy commercialization, preparation and promotion, high drug efficacy, and avoiding a single route of administration.

Active Publication Date: 2022-04-19
RENJI HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
View PDF8 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] Aiming at the technical problems in the prior art, the invention provides a kind of Akkermansia Amuc_2172 protein and its preparation method and application, and the described Akkermansia Amuc_2172 protein and its preparation method and application should solve the existing There are technical problems in the technology that the treatment of intestinal inflammation and cancer is not effective

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ackerman bacteria Amuc2172 protein as well as preparation method and application thereof
  • Ackerman bacteria Amuc2172 protein as well as preparation method and application thereof
  • Ackerman bacteria Amuc2172 protein as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Akkermansia protein purification: clone Akkermansia Amuc_2172 gene (see https: / / www.ncbi.nlm.nih.gov / nuccore / CP001071.1?from=2650234&to=2650734) (gene sequence is: atgccgactc tccgccaagc cgccaaggac gacatcacgc tgatccatga actggcctgccaggcttttc cggccacata ccgggacctc ctttccagag agcagataga tttcatgatg gactggatgtattcccccgc caacctggaa aaacagatgg aggaggggca cgtgtacttc atcgcctccc atgagggaaaggactgcggc tacctgtccg tccagccgga aggccccggc gtcttccatt tgcagaaaat ctacgttctgcccggcttcc agggcctgca tataggaagc tttctgttcc gccacgccat cagctacatc agaagcatccacccggaacc gtgcctgatg cgcctgaacg tgaaccgcga taacacccgg gcggtggaat tctaccagcgcatgggcatg cggaccctgg aacgcgggga tttccacatc ggccacggtt actacatgac ggactacatcatgggactgg atatagcctg a)(SEQ ID NO.2 shown) and the Amuc_1100 gene (see https: / / www.ncbi.nlm.nih.gov / nuccore / CP001071.1?from=1314411&to=1315364) (the gene sequence is: ttaatcttca gacggttcct gagccttggg ctggttgaag tggaccagat tcagggagacctggacag gacctggtggctcctggctgcatg tgcaggtgcagccgcctcat ccgccggagt c...

Embodiment 2

[0042] Example 2 evaluates the effect of Amuc_2172 on Th17:

[0043]Wild-type C57BL / 6J (8-10 weeks old) mice were taken, killed by neck pulling, and spleens were taken under aseptic conditions. In a beaker filled with 10ml of 4°C normal saline, cut it into pieces with ophthalmic scissors, gently grind it through a 200-mesh nylon mesh, and then sieve it to collect the cell suspension. Centrifuge the suspension at 600×g for 5 min. Discard the supernatant, observe the volume of the precipitated cells, add red blood cell lysate at a volume ratio of 10:1, mix well and let it stand for 2 minutes, then immediately add 10ml of 4°C normal saline, centrifuge at 600×g for 5 minutes. The supernatant was discarded, and the cells were repeatedly washed twice with 4°C saline. Carry out cell count before the last centrifugation, and resuspend cells with RPMI-1640 complete medium (the RPMI-1640 that contains volume percent concentration is 10% fetal bovine serum adds penicillin and streptomy...

Embodiment 3

[0045] Example 3 Safety Assessment of Amuc_2172 Different Administration Methods:

[0046] Wild-type C57BL / 6J (8-16 weeks old) mice were taken, and no more than 5 mice were raised in each cage. The mice were marked and weighed for their reference body weight. Thirty mice were randomly divided into three groups. In the control group (Ctrl, Control group) animals, physiological saline was injected into the tail vein. In the injection group, 150 μg / kg body weight of Amuc_2172 protein was injected into the tail vein. The animals were injected from the 0th day, injected three times a week, observed the general condition of the animals every day, water intake, body weight, and stool properties.

[0047] The daily body weight loss percentage of the animal was calculated using the following formula: [(body weight-reference body weight) / reference body weight]×100. On the 10th day of feeding, the experiment ended and the animals were sacrificed. Evaluate the survival status and body ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an Ackerman bacteria Amuc2172 protein, which contains an amino acid sequence as shown in SEQ ID NO. 1 or SEQ ID NO. 5. The Ackerman bacteria Amuc2172 protein has the advantages that the Akerman bacteria Amuc2172 protein can be used for preparing a recombinant strain; the invention also provides a preparation method of the Akkerman's bacteria Amuc2172 protein, and the Akkerman's bacteria Amuc2172 protein can be used for preparing the The invention further provides a pharmaceutical composition, and the pharmaceutical composition contains a therapeutically effective amount of the ackermania Amuc2172 protein. The invention also provides an application of the Ackerman's bacteria Amuc2172 protein in preparation of a medicine for inhibiting Th17 cell differentiation or intestinal inflammation or intestinal cancer, and also provides an application of the Ackerman's bacteria Amuc2172 protein in preparation of a medicine for inhibiting Th17 cell differentiation or intestinal inflammation or intestinal cancer. The invention finds that an active ingredient Amuc2172 protein of Ackerman's bacteria can inhibit Th17 cells, treat and relieve intestinal inflammation and generation and development of intestinal tumors, and can be used for treating various autoimmune diseases related to Th17, including but not limited to Crohn's disease, ulcerative colitis, multiple sclerosis, rheumatoid arthritis and systemic lupus erythematosus.

Description

technical field [0001] The invention belongs to the field of biomedicine and relates to an Akkermansia Amuc_2172 protein, specifically an Akkermansia Amuc_2172 protein and a preparation method and application thereof. Background technique [0002] Intestinal disease is a worldwide health problem. Unhealthy diet and mental stress lead to the gradual deterioration of global intestinal inflammation and tumor epidemiology, which has an adverse impact on patients' physical, mental, family and national economic production. Ulcerative colitis (UC) and Crohn's disease (CD) both belong to inflammatory bowel disease (Inflammatory Bowel Disease, IBD). Chronic diseases are currently incurable, and once diagnosed, life-long treatment will bring great physical and mental burdens to patients and their families. Recurrent intestinal inflammation in UC promotes colorectal cancer (UC related Colorectal Cancer, UC-CRC). The canceration rate of UC patients with a disease course of more than 10...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/195C12N15/31C12N15/70C12N15/62A61K38/16A61P37/02A61P1/00A61P1/04A61P19/02
CPCC07K14/195C12N15/70A61K38/164A61P37/02A61P1/00A61P1/04A61P19/02C07K2319/21
Inventor张明明蒋怡
OwnerRENJI HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE