A polymerase mutant and its application

A mutant and polymerase technology, applied in the field of molecular biology, can solve the problems of DNA chain duplication of double-stranded DNA, inability to use catalytic loop to mediate isothermal amplification, etc., to achieve increased specificity, high cDNA synthesis efficiency and detection sensitivity , the effect of improving enzyme concentration

Active Publication Date: 2022-08-05
SHANGHAI ZHONGQI BIOTECHNOLOGY CO LTD +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In contrast, ZO5 DNA polymerase has strong reverse transcriptase polymerase chain reaction (RT-PCR) activity, but cannot make DNA strands replicate double-stranded DNA through strand displacement, so it cannot be used to catalyze loop-mediated isothermal Amplification (LAMP) or RT-LAMP

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A polymerase mutant and its application
  • A polymerase mutant and its application
  • A polymerase mutant and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Expression and purification of polymerase mutants

[0034] 1. Preparation of polymerase mutant gene expression vector. Take the plasmid template of ZO5 wild-type polymerase gene (SEQ ID NO: 2), and use E628K-F, E628K-R, IE709LK-F, IE709LK-R, EA744RR-F, EA744RR-R as mutation primers, and use ZO5- Nde1-F and ZO5-Sal1-R were truncated PCR primers, and 1 μL of primers (10 μM) were added to a 50 μL reaction system. The mix uses a PCR reaction system of 50 μL, including 10 × buffer (100 mM KCl, 100 mM (NH 4 ) 2 SO 4 , 200mM Tris-HCl pH=8.8, 20mM MgSO 4, 5 μL of 1% TritonX-100, 1 mg / mL BSA), 3 μL of 2 mM dNTPs, 1 μL of KOD enzyme. A total of 25 cycles of amplification program: 95°C, 1min; 95°C, 30s; 60°C, 30s; 68°C, 2min; 68°C, 5min, 4°C preservation. Amplification primers are shown in Table 1. Among them, IE709LK stands for I709L, E710K, EA744RR stands for E744R, A745R.

[0035] Table 1 Amplification primer sequences

[0036] primer name sequen...

Embodiment 2

[0039] Example 2: RT-PCR of polymerase mutants

[0040] The RNA prepared by the DNA sequence of MS2 of the published patent CN113846146A was used as a template (DNA sequence shown in SEQ ID NO: 8), and each well contained 3 μL of ZO5 L1 and ZO5 L2 enzymes diluted 10 times with buffer, ZO5 wild-type polymerase was used as a control for PCR and RT-PCR. In each group, the buffer contained 20 mM Tris-HCl (pH=8), 100 mM KCl, 0.1 mM EDTA, 0.1% Tween-2. Each was added to 12 μL of RT-PCR master mix as shown in Table 2, and thermocycling was performed. Thermal cycling conditions were: 50°C, 2 minutes ("UNG" step); 65°C, 2 minutes ("RT" step); 5 cycles of 94°C, 15 seconds; followed by 62°C, 30 seconds; One cycle of 91°C, 15 seconds; followed by 62°C, 30 seconds.

[0041] Table 2 RT-PCR master mix

[0042] component concentration Tris-HCl (pH=8) 50mM KOAc 60mM glycerin 5% (v / v) DMSO 2% (v / v) MgCl2 2mM Primer 1 200nM Primer 1 ...

Embodiment 3

[0044] Example 3: Reaction temperature test of LAMP of polymerase mutants

[0045] Design primers to detect MS2-specific genes (MS2 gene sequence is shown in SEQ ID NO: 8), the design of MS2 primer sequences is shown in Table 3, and the reaction system is shown in Table 4.

[0046] Table 3 MS2 primer sequences

[0047] primer name sequence (5'to3') MS2-BIP GCACGTTCTCCAACGGTGCTGGTTGCTTGTTCAGCGAACT MS2-FIP GCCCAAACAACGACGATCGGTAAAACCAGCATCCGTAGCCT MS2-LB TGCAGGATGCAGCGCCTTA MS2-LF CCAGAGAGGAGGTTGCCAA MS2-B3 CAATAGAGCCGCTCTCAGAG MS2-F3 TGTCATGGGATCCGGATGTT

[0048] Table 4 Reaction system

[0049] sample concentration Addition amount (uL) MS2 Template 1ng / uL 1 MS2-BIP 10um 1.6 MS2-FIP 10um 1.6 MS2-LF 10um 0.8 MS2-LB 10um 0.8 MS2-F3 10um 0.2 MS2-B3 10um 0.2 dNTP / dUTP Mixture 25mM 0.8 Mg 2+

100mM 1 10×buffer \ 2.5 DNA polym...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular biology, in particular to a ZO5 DNA polymerase mutant and its application. The specific technical solution is: a ZO5 DNA polymerase mutant obtained by mutation on the basis of ZO5 wild-type polymerase, the amino acid sequence of the ZO5 wild-type polymerase is shown in SEQ ID NO: 1; the mutation site includes: E628K , I709L, E744R, A745R. The polymerase mutants provided by the present invention can expand their ability of various activities including reverse transcriptase, and can use RNA templates to catalyze reverse transcription loop-mediated isothermal amplification. Polymerase mutants after fusion binding peptides have strong anti-interference ability, such as chocolate, peanut butter, milk, seafood, meat or eggs, chocolate, pepper, blood, urine, humic acid, bile, tannin, melanin, Interference from indigo dyes, plant materials, etc.; and can effectively shorten the time required for LAMP.

Description

technical field [0001] The invention belongs to the field of molecular biology, in particular to a polymerase mutant and its application. Background technique [0002] Taq polymerase and Bst polymerase are two well-known thermostable DNA polymerases, and their crystal structures share 50% sequence homology. Taq polymerase can catalyze PCR (this reaction requires the enzyme to withstand 94°C), but the activity of Bst polymerase is 65-70°C, so it cannot catalyze PCR. At the same time, Taq polymerase cannot replicate double-stranded DNA by displacing its preceding DNA strand, and the 5'-endonuclease of Taq polymerase will degrade the substituted DNA; but Bst polymerase can efficiently carry out strand displacement without degradation , and are therefore commonly used to catalyze loop-mediated isothermal amplification (LAMP). However, neither Taq polymerase nor Bst polymerase has reverse transcriptase (RT) activity, so it is usually necessary to combine a separate RT enzyme wi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/12
CPCC12N9/1252C12N9/1276C12Y207/07007C12Y207/07049Y02A50/30
Inventor胡学军曹利勤
OwnerSHANGHAI ZHONGQI BIOTECHNOLOGY CO LTD