Check patentability & draft patents in minutes with Patsnap Eureka AI!

Primer and probe composition for detecting helicobacter pylori 23SrRNA gene mutation as well as application and kit of primer and probe composition

A technology for Helicobacter pylori and Helicobacter pylori, applied in DNA/RNA fragments, recombinant DNA technology, microorganism-based methods, etc., can solve the problems of high specificity and sensitivity, and achieve the effect of improving the detection rate

Pending Publication Date: 2022-06-03
BEIJING XINJI YONGKANG BIOTECH
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method has high sensitivity, and its main limiting factor is that if the mutation position is a weak base sequence, the specificity of the method will be affected

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and probe composition for detecting helicobacter pylori 23SrRNA gene mutation as well as application and kit of primer and probe composition
  • Primer and probe composition for detecting helicobacter pylori 23SrRNA gene mutation as well as application and kit of primer and probe composition
  • Primer and probe composition for detecting helicobacter pylori 23SrRNA gene mutation as well as application and kit of primer and probe composition

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Example 1: Design and Synthesis of Primer and Probe Compositions

[0066] Primers and probes were designed according to the known 23S rRNA gene sequence of the Helicobacter pylori gene in the Genebank DNA sequence database.

[0067] The 23S rRNA gene sequence of the Helicobacter pylori gene is shown in SEQ ID NO.1.

[0068] (GTTAAATACCGACCTGCATGAATGGCGTAACGAGATGGGAGCTGTCTCAACCAGA GATTCAGTGAAATTGTAGTGGAGGTGAAAATTCCTCCTACCCGCGGCAAGACGGAAAG ACCCCGTGGACCTTTACTACAACTTAGCACTGCTAATGGGAATATCATGCGCAGGATAGG TGGGAGGCTTTGAAGTAAGGGCTTTGGCTCTTATGGAGCCATCCTTGAGATACCACCCTGCTTGATGTTAGTCAGCTAGCTGCCCTTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTGATCAGCTAGCTAGCTTAGCTAGCTAGCTAGCATGGACT

[0069] Primer and probe composition for 23S rRNA gene mutation

[0070] 23S-A2142G forward mutant primer 5'-GTAAAGGTCCACGGGGTCTTC-3', as shown in SEQ ID NO.2;

[0071] 23S-A2142C forward mutant primer...

Embodiment 2

[0090] Example 2: Extraction of DNA from the sample to be tested

[0091] Using the magnetic bead method paraffin-embedded tissue genomic DNA extraction kit, DNA was extracted from human paraffin-embedded tissue, and finally 100 μL of DNA extraction solution was obtained. The DNA extraction solution can be directly used in real-time quantitative PCR reaction, and the maximum amount of each real-time quantitative PCR reaction is 10 μL. The remaining DNA extract was stored at -80°C.

Embodiment 3

[0092] Example 3: Kit for Detection of Helicobacter pylori 23S rRNA Gene Mutation

[0093] The specific composition of the kit for detecting Helicobacter pylori 23S rRNA gene mutation is shown in Table 1.

[0094] Table 1 The specific composition of the kit for detecting Helicobacter pylori 23S rRNA gene mutation

[0095]

[0096]

[0097] Among them, 17 μL of 23S rRNA reaction solution and 3 μL of 23S enzyme mixture formed a reaction system for single-tube multiplex fluorescence quantitative PCR reaction.

[0098] When preparing a reaction system for a single-tube multiplex fluorescence quantitative PCR reaction, the number of prepared copies of the reaction system = the number of samples to be tested + 2 copies. Divide the prepared reaction system into PCR reaction tubes according to the amount of 20 μL each, add 10 μL of 23S positive control and 10 μL of 23S negative control to 2 PCR reaction tubes respectively, and add 10 μL of 23S negative control to other PCR re...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biological detection, and particularly discloses a primer and probe composition for detecting helicobacter pylori 23S rRNA gene mutation, application of the primer and probe composition and a kit. The primer and probe composition comprises a mutant primer and probe composition for detecting an A2142C site, an A2142G site and an A2143G site of a helicobacter pylori 23S rRNA gene, a primer and probe composition for detecting a helicobacter pylori 16S rRNA gene, a primer and probe composition for detecting a human RNAse P gene, and a blocking primer. The primer and probe composition is applied to preparation of a reagent or a kit for detecting helicobacter pylori 23S rRNA gene mutation. The kit comprises the primer and the probe composition. According to the application, the detection efficiency of helicobacter pylori 23S rRNA gene mutation is improved.

Description

technical field [0001] The present application relates to the technical field of biological detection, in particular to a primer and probe composition for detecting Helicobacter pylori 23S rRNA gene mutation, its application and a kit. Background technique [0002] Helicobacter Pylori (HP) infection is closely related to upper gastrointestinal diseases, including gastritis, peptic ulcer disease, gastric mucosa-associated lymphoid tissue (MALT) lymphoma and gastric cancer. Helicobacter related. Treatment to eradicate Helicobacter pylori is considered an effective treatment for H. pylori-related diseases. At present, clarithromycin is one of the commonly used antibiotics for clinical eradication of Helicobacter pylori, but due to the wide application of the drug, the drug resistance rate of Helicobacter pylori is increasing year by year, and the eradication rate of Helicobacter pylori is declining. According to studies, point mutations in the 23S rRNA gene V domain peptidylt...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12Q1/6851C12N15/11C12R1/01
CPCC12Q1/689C12Q1/6851C12Q2600/156C12Q2600/16C12Q2531/113C12Q2537/143C12Q2563/107C12Q2535/137Y02A50/30
Inventor 韩晶韩敏任鹏飞王俊峰王玉朗
Owner BEIJING XINJI YONGKANG BIOTECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More