Primer and probe composition for detecting helicobacter pylori 23SrRNA gene mutation as well as application and kit of primer and probe composition
A technology for Helicobacter pylori and Helicobacter pylori, applied in DNA/RNA fragments, recombinant DNA technology, microorganism-based methods, etc., can solve the problems of high specificity and sensitivity, and achieve the effect of improving the detection rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0065] Example 1: Design and Synthesis of Primer and Probe Compositions
[0066] Primers and probes were designed according to the known 23S rRNA gene sequence of the Helicobacter pylori gene in the Genebank DNA sequence database.
[0067] The 23S rRNA gene sequence of the Helicobacter pylori gene is shown in SEQ ID NO.1.
[0068] (GTTAAATACCGACCTGCATGAATGGCGTAACGAGATGGGAGCTGTCTCAACCAGA GATTCAGTGAAATTGTAGTGGAGGTGAAAATTCCTCCTACCCGCGGCAAGACGGAAAG ACCCCGTGGACCTTTACTACAACTTAGCACTGCTAATGGGAATATCATGCGCAGGATAGG TGGGAGGCTTTGAAGTAAGGGCTTTGGCTCTTATGGAGCCATCCTTGAGATACCACCCTGCTTGATGTTAGTCAGCTAGCTGCCCTTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTGATCAGCTAGCTAGCTTAGCTAGCTAGCTAGCATGGACT
[0069] Primer and probe composition for 23S rRNA gene mutation
[0070] 23S-A2142G forward mutant primer 5'-GTAAAGGTCCACGGGGTCTTC-3', as shown in SEQ ID NO.2;
[0071] 23S-A2142C forward mutant primer...
Embodiment 2
[0090] Example 2: Extraction of DNA from the sample to be tested
[0091] Using the magnetic bead method paraffin-embedded tissue genomic DNA extraction kit, DNA was extracted from human paraffin-embedded tissue, and finally 100 μL of DNA extraction solution was obtained. The DNA extraction solution can be directly used in real-time quantitative PCR reaction, and the maximum amount of each real-time quantitative PCR reaction is 10 μL. The remaining DNA extract was stored at -80°C.
Embodiment 3
[0092] Example 3: Kit for Detection of Helicobacter pylori 23S rRNA Gene Mutation
[0093] The specific composition of the kit for detecting Helicobacter pylori 23S rRNA gene mutation is shown in Table 1.
[0094] Table 1 The specific composition of the kit for detecting Helicobacter pylori 23S rRNA gene mutation
[0095]
[0096]
[0097] Among them, 17 μL of 23S rRNA reaction solution and 3 μL of 23S enzyme mixture formed a reaction system for single-tube multiplex fluorescence quantitative PCR reaction.
[0098] When preparing a reaction system for a single-tube multiplex fluorescence quantitative PCR reaction, the number of prepared copies of the reaction system = the number of samples to be tested + 2 copies. Divide the prepared reaction system into PCR reaction tubes according to the amount of 20 μL each, add 10 μL of 23S positive control and 10 μL of 23S negative control to 2 PCR reaction tubes respectively, and add 10 μL of 23S negative control to other PCR re...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


