Application of small molecule compound in preparation of human La protein inhibitor

A technology of protein inhibitors and compounds, applied in the field of pharmaceuticals, can solve problems such as shortening, accelerated cell proliferation, and out of control

Pending Publication Date: 2022-06-28
THE OBSTETRICS & GYNECOLOGY HOSPITAL OF FUDAN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

CCND1 regulates the cell cycle progression in the G1 / S phase, and overexpression will lead to a significant shortening of the G1-S phase interval, resulting in accelerated or even uncontrolled cell proliferation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of small molecule compound in preparation of human La protein inhibitor
  • Application of small molecule compound in preparation of human La protein inhibitor
  • Application of small molecule compound in preparation of human La protein inhibitor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Computer high-throughput virtual screening docking screening of La protein inhibitor candidate compounds

[0035] use The software Maestro module is used for the docking analysis of La proteins with compounds in the 1.5 million ChemDiv compound library. The 2D ligand structures of the compound molecules were obtained from the ChemDiv compound library. The receptor structure was retrieved from the available crystal structures of the La protein and utilized Software's Protein Preparation Wizard module to build. The receptors were constructed using all chains of the protein structure, and water molecules more than 5 Angstroms away from the protein position were removed. Then, the potential allosteric sites of the La protein were predicted with AlloSitePro. Then, the prepared ligand was flexibly connected to the predicted binding site of the receptor with the default parameter Glide (XP mode). Finally, several docking poses of the molecule were obtained, and ...

Embodiment 2

[0041] Example 2 SPR single-concentration primary screening to determine the affinity of human La protein and candidate compounds

[0042] 1. Expression and purification of recombinant human La protein in E. coli system

[0043] The full-length amino acid sequence of human La protein (containing 408 amino acids) was obtained from Pubmed protein, and the following sequence was added to the C-terminus of the obtained human La protein sequence: AGCCGGGGAGGCCAAAGCTTATCCACCCCGAGTGTAGATCTCGGTGGTCGCCGTATCATTGGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAACATCATCACCACCATCACTCT. Using MaxCodon TM Optimization Program (V13) software optimizes the above amino acid sequence, adopts whole gene synthesis and inserts the Lupus La gene into the expression vector pET30a through restriction enzyme sites NdeI and HindIII, and confirms the final expression vector by enzyme digestion and sequencing The accuracy was finally transferred to Top10 clone strain and BL21(DE3) expression strain respective...

Embodiment 3

[0053] Example 3 Immunofluorescence polarization competition assay detects the in vitro inhibitory effect of compounds on La protein

[0054] 1. Construction of a fluorescence polarization detection system for the binding efficiency of human La protein and RNA probes

[0055] The synthetic scheme of recombinant human La protein is shown in Example 2. According to the binding site of La protein and RNA in the literature, 3 short-chain RNA probes (see Table 3) are designed. The probes are labeled with FAM fluorescence at the 5' end. Synthesized by Industrial Bioengineering (Shanghai) Co., Ltd.

[0056] table 3

[0057]

[0058] Table 3 RNA fluorescent probes used in immunofluorescence polarization competition experiments

[0059] Prepare assay buffer on ice: 50 mM Tris-HCl PH=8, 50 mM NaCl, 5 mM MgCl2, 2 mM DTT, 0.1 mM EDTA (prepared and used now). Use the prepared 1X assay buffer to dilute 10-fold in 100% DMSO to prepare a 10X working solution. The three RNA probes and r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of pharmacy, and relates to an application of small molecule compounds ZINC5921027 and ZINC1413516 in preparation of human La protein inhibitors, in particular to an application in preparation of drugs for preventing, delaying or treating high-expression human La protein participated or mediated diseases. The small molecule compound can be effectively combined with human La protein, inhibits the most basic biological function of the La protein, and plays a role of a human La protein inhibitor. The prepared human La protein inhibitor is suitable for treating malignant tumors participated or mediated by a high La protein expression pathway and diseases secondary to increase of virus replication participated or mediated by the high La protein expression pathway. The malignant tumors comprise ovarian cancer, cervical cancer, endometrial cancer, breast cancer, liver cancer, head and neck lymphocyte cancer, oral lymphocyte cancer, leukemia, lymphoma and the like. Diseases secondary to the increased virus replication include hepatitis B, hepatitis C and herpes simplex.

Description

technical field [0001] The invention belongs to the field of pharmaceutical technology, and relates to the use of small molecular compounds in the preparation of human La protein inhibitors, in particular to two compounds ZINC5921027 and ZINC1413516 and their new applications in the preparation of medicines, especially in the preparation of prevention, delay or treatment of high expression Use of human La protein in medicine for diseases involved or mediated. Background technique [0002] The prior art discloses that human La protein (RNA-binding protein La) is a multifunctional RNA-binding protein containing 408 amino acids, which has important functions in the processing and metabolism of RNA; Recognition motif 1 (RRM1) and noncoding RNA recognition motif 2 (RRM2) bind RNA. RRM2 is located at the characteristic C-terminal extension of mammalian La proteins. The C-terminal region of the La protein also contains nuclear localization, nucleolar localization and nuclear rete...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/427A61K31/404A61P35/00A61P35/02A61P1/16A61P31/20A61P31/14A61P31/22
CPCA61K31/427A61K31/404A61P35/00A61P35/02A61P1/16A61P31/20A61P31/14A61P31/22A61K2300/00
Inventor汤静黄璇李月妍
OwnerTHE OBSTETRICS & GYNECOLOGY HOSPITAL OF FUDAN UNIV