Method for removing DNA pollution in nucleic acid amplification
A nucleic acid and inactivation technology, applied in the field of DNA contamination removal, can solve problems such as unsuitability and inability to solve the contamination of genome template types
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] Example 1. Experiment of DNase I using concentration range
[0069] 1.1 Experimental materials
[0070]
[0071]
[0072] Primer sequence:
[0073] HLA-B-Exon3-F: CCGGGGCCAGGGTCTCAC
[0074] HLA-B-Exon3-R: CCATCCCCGGCGACCTATAGGAG
[0075] 1.2 Experimental part
[0076] ⅰ. The first preparation concentration is 20mM sodium acetate (pH 6.5), 5mM CaCl 2 , 0.1 mM PMSF, 50% glycerol DNase I stock solution.
[0077] 2. Preparation of DNase I dilution solution: before dilution, take 50ul of 1M MgCl 2 Then add 4950ul DNase storage solution, shake and mix well, and dilute it as a diluent. DNase I was then diluted according to the table below.
[0078] The enzyme activity of DNase I enzyme stock solution is 1×10 7 U / μL, firstly make 4 serial 10-fold gradient dilutions of the mother solution with DNase I dilution solution, which are marked as 2, 3, 4, and 5. The enzyme activities after dilution are:
[0079] 1: 1×10 7 U / μL (stock solution)
[0080] 2: 1×10 6 U / μL...
Embodiment 2
[0107] Embodiment 2. DNase I treats the experiment of PCR water
[0108] 2.1 Experimental materials
[0109] Same as Example 1
[0110] 2.2 Experimental part
[0111] ⅰ, water treatment
[0112] First take a 50ml centrifuge tube, add 100ul DNase I (10000U / ml), 100ul 1M MgCl 2 , add 9800ul of ultrapure water, then dispense into 1.5ml centrifuge tubes, each tube is 1.7ml, a total of 5 tubes, numbered 1-5 respectively; then place the water on a metal bath at 37°C for heating for 120min, and then place it on Completely inactivate by reacting at 99°C for 20min on another metal bath, then use the water in 1-5 tubes to dilute the primers and serve as PCR water;
[0113] ii. PCR reaction system
[0114] Experimental group 1: (no DNase group was added to the PCR system) (1-8)
[0115]
[0116] First divide the above PCR reaction system into 10 PCR tubes, invert the PCR tubes upside down, completely wet the walls of the tubes with the liquid in the PCR tubes, centrifuge briefly...
Embodiment 3
[0134] 3.1 Experimental materials
[0135] Same as Example 1
[0136] 3.2 Experimental part
[0137] When using DNase I to treat the PCR amplification system, it was found that when the contamination was completely eliminated, the amplification of the positive band occasionally appeared not bright. When the positive band was completely bright, the phenomenon of amplification contamination appeared again. Dnase I digestion and inactivation steps before amplification, the conditions are as follows:
[0138] component Volume (μl) Genext Buffer 20.3 B-Exon2-F (10μM) 0.6 B-Exon2-R (10μM) 0.6 DNase I (1000U / μL) 1.2 ddH 2 O
0.1 Thermo Taq (5U / μL) 0.4
[0139] Before amplification, prepare all components except template DNA, and dispense 23ul per reaction into each PCR tube, and flick the PCR tube with your finger to make the liquid completely wet the entire PCR tube wall, then Then set up the following experimental groups:
...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More