Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of corn ZmPRA1C1 gene in improving heat stress resistance of plants

A gene and corn technology, applied in the application field of corn ZmPRA1C1 gene in improving plant heat stress resistance, to achieve the effect of reducing heat damage, reducing wilting degree, and facilitating growth and development

Pending Publication Date: 2022-07-26
SHANDONG AGRICULTURAL UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, the mutants of this gene are defective in vacuolar transport, while overexpression inhibits the outward transport of a series of proteins in the Golgi apparatus, including vacuolar proteins, plasma membrane proteins, trans-Golgi proteins, etc., but also Not all types of Golgi export proteins are inhibited, such as secreted proteins

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of corn ZmPRA1C1 gene in improving heat stress resistance of plants
  • Application of corn ZmPRA1C1 gene in improving heat stress resistance of plants
  • Application of corn ZmPRA1C1 gene in improving heat stress resistance of plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1: Obtainment of transgenic lines

[0028] (1) Sequence analysis, cloning and vector construction of maize ZmPRA1C1 gene

[0029] The present invention uses the maize genome database website (https: / / www.maizegdb.org) to find the gene ZmPRA1C1, the full-length genome sequence is 3529bp (the sequence is shown in SEQ ID NO. 1), and the CDS sequence is 582bp (the sequence is as shown in SEQ ID NO.1) ID NO. 2), the size of the protein encoded by the gene is 193 amino acids (the sequence is shown in SEQ ID NO. 3).

[0030] Primers were designed according to the CDS sequence of the found maize ZmPRA1C1 gene and cloned. The cloning method is as follows:

[0031] 1. Extraction of RNA: The total RNA of maize was extracted using the omnipotent plant RNA extraction kit (Item No. CW2598) of Kangwei Century Company.

[0032](1) Take 0.1-0.2 g of corn tissue and grind it into powder in liquid nitrogen, add 500 μL of Buffer RLS, and immediately vortex to mix;

[0033] (2) 4...

Embodiment 2

[0071] Example 2: Identification of ZmPRA1C1 expression in transgenic lines

[0072] According to the requirements of qRT-PCR primer design, software such as Beacon Designer 7 and Primer Premier 5.0 were used to design gene-specific primers. Select the SYBR Green Design option, create a file, input the sequence, run the BLASTsearch sequence and Template structure search tools, run the Primer search tool, and select the optimal primer sequence (first ensure primer specificity and then consider avoiding the impact of template structure). The primers were synthesized in Shanghai Sangon Bioengineering Service Co., Ltd. and purified by PAGE. The primer sequences were as follows:

[0073] qRT-ZmPRA1C1-F:CCCCGTCTCCCTCATCGTAT; (SEQ ID NO. 6)

[0074] qRT-ZmPRA1C1-R: GTGAGGAGGAGCAGGACGA; (SEQ ID NO. 7)

[0075] The 96-well plate (Axygen, USA) and high transmittance sealing film (Axygen, USA) were used for qRT-PCR, and Icycler real-time PCR system (Bio-Rad, USA) was used for qRT-PCR a...

Embodiment 3

[0080] Example 3: The effect of the maize ZmPRA1C1 gene on the phenotype of seedlings under heat stress

[0081] (1): Culture of transgenic maize overexpressing ZmPRA1C1

[0082] Corn seeds were sterilized with 70% ethanol for 5 minutes, then with 15% sodium hypochlorite for 5 minutes, and finally with sterile ddH 2 O rinsed 5-7 times, sterilized sterile seeds were planted in the substrate and placed in a long-day incubator at 25°C for 14 days. Long-day conditions were 16h light / 8h dark, 25°C.

[0083] (2): Observation of phenotypes under heat stress in overexpressing ZmPRA1C1 transgenic lines

[0084] 30 corn seedlings of B104 wild type, OE-1 and OE-2 with the same growth in (1) were selected. At the same time, they were subjected to heat stress treatment at 45°C for 5.5 hours in a thermal incubator, and the growth status of the seedlings before and after treatment was observed and photographed. , the result is Figure 3A As shown, under normal conditions, there is no sig...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an application of a corn ZmPRA1C1 gene in improving the heat stress resistance of plants. According to the invention, a gene ZmPRA1C1 is separated and cloned from corn, a CDS sequence of the ZmPRA1C1 is connected to an expression vector pCAMBIA3300 driven by a Ubi promoter, an overexpression vector of the corn ZmPRA1C1 gene is obtained through a gene engineering technology, an overexpression strain of corn is obtained, and the overexpression homozygous strain of the corn ZmPRA1C1 gene is finally obtained after screening. Experimental results show that the gene can enable a model plant corn to have good heat stress resistance, specifically, the fresh weight of the overground part of a seedling under heat stress can be increased, and the damage degree of corn cells can be reduced. Experiments confirm that the corn ZmPRA1C1 gene has potential application value in improvement of corn heat resistance, and a good theoretical and application foundation is laid for cultivation of heat-resistant corn varieties by using the gene.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to the application of maize ZmPRA1C1 gene in improving plant heat stress resistance. Background technique [0002] Temperature is one of the key physical parameters affecting life on Earth. As a result, nearly all organisms have evolved signaling pathways to sense slight changes in ambient temperature and adjust their metabolism and cellular functions to prevent heat-related damage. Heat stress can adversely affect all aspects of plant growth, development, reproduction and yield. Since plants are organisms that are fixed in the soil and cannot escape heat, they mainly change their metabolism in the body to prevent damage caused by heat through thermal domestication. Programmed cell death, leading to leaf drop, flower fading, fruit loss, and even the death of the entire plant. Drought and extreme heat reduced global cereal production by 10.1% and 9.1%...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/84A01H5/00A01H6/46
CPCC07K14/415C12N15/8271C12N15/8261Y02A40/146
Inventor 黄金光解晨郑成超白冰
Owner SHANDONG AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com