Classical swine fever virus detection method based on G4-ThT biosensor and NASBA and kit thereof
A biosensor, swine fever virus technology, applied in the field of genetic engineering, can solve the problems of high cost and expensive
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0020] 1. Preparation kit, which consists of:
[0021] (1) NASBA reaction buffer includes: 50mM Tris / HCl pH8.5, 10mM MgCl 2 , 90 mM KCl, 10 mM DTT, 1 mM each dNTP, 2 mM each NTP, 10% (v / v) DMSO;
[0022] (2) NASBA forward primer and reverse primer, including: 0.4 μM forward primer E2F-GG29: CCCCTACCTCCCGCCCCTACCCGTCCCCC-CACCACCTGGAAAGAA; 0.4 μM reverse primer E2R-T7: AATTCTAATACGACTCACTATAGGGAGATACCTCCTACTGACCA; wherein the front end of the forward primer contains G-quadruplex sequence The reverse complementary sequence of GG29 is CCCCTACCTCCCGCCCCTACCCGTCCCCC and the CSFV-E2 binding sequence CACCACCTGGAAAGAA. The front end of the reverse primer is added with the T7 promoter sequence AATTCTAATACGACTCACTATAGGGAGA and the CSFV-E2 binding sequence TACCTCCTACTGACCA;
[0023] (3) NASBA enzyme reaction solution, including: 4mM DTT, 2μg BSA, 30U T7 RNA polymerase (Thermo Scientific), 6U AMV-Rt (Promega), 0.1u RNase H (Thermo Scientific);
[0024] (4) G-quadruplex amplification prod...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

