Polypeptide motif bound with human CD95 and its polypeptide
A CD95, peptidyl technology, applied in DNA, RNA, reagents or medicines, functional peptide field, can solve the problems of natural CD95L technical difficulties, unrealistic large-scale preparation, and murine problems, etc. Ease of mass production, great application potential, effect of enhancing activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0164] Embodiment 1 chemically synthesized polypeptide and its mass spectrometry detection
[0165] Peptides based on the characteristics of [Motif ID No: 1] or [Motif ID No: 2] can produce a lot of polypeptide sequences due to the combination, the following is only a polypeptide [SEQ ID No 2] based on [Motif ID No: 1] As an example, it is illustrated that the polypeptide can be obtained by the following method. The synthesis of the polypeptide [SEQ ID No 2] adopts a solid-phase synthesis method on a peptide synthesizer of ABI Company. The carrier resin used is HMP amino acid resin, the amount of amino acid is 1 mmol, ie amino acid:resin=4:1. According to the amino acid sequence of the polypeptide [SEQ ID No 2], the components of each amino acid are added in sequence for solid-phase synthesis. After the peptide is synthesized, according to the steps recommended by the PE company, add the synthesis after ice bath to 10ml cutting solution under ice bath conditions for cutting....
Embodiment 2
[0166] Embodiment 2 prepares fusion type polypeptide
[0167] 1) Synthesis of DNA encoding the polypeptide and primers
[0168] The DNA synthesizer uses solid-phase synthesis as a means, the carrier resin used is provided by ABI Company, and the operation steps are carried out according to the experimental manual provided by ABI Company. Both ends of the DNA sequence encoding the polypeptide are respectively designed as recognition sequences for EcoR I and BamH I endonucleases. Taking the fusion polypeptide of [SEQ ID No 2] polypeptide (fused with phage coat protein gp8) as an example, the construction, synthesis and secretion of the fusion polypeptide are described in detail. The procedure input during the synthesis of the DNA sequence [SEQ DNA No 2] encoding the polypeptide of [SEQ ID No 2] is as follows:
[0169] A: 5'GCGGGATCCGATGTTTTTTTTTTAGCTACGACGTTCGCGAATTCACCCG3'
[0170] B: Primer: 5'CGGGTGAATTC3'
[0171] After the synthesis was completed, the resin was removed ...
Embodiment 3
[0192] Example 3 Binding activity of fusion polypeptide to CD95 receptor protein (with Fas.Fc and cells)
[0193] According to the method of Liu Beiyi and others [Journal of Immunology, 14, 54-55, 1998], the recombinant phage clones displaying the polypeptide of the present invention on the surface were purified twice with PEG, and 1× of each clone was added to each well of the enzyme-linked plate. 1011 phage particles, wait for the water to evaporate at 37°C. After adding 10% formaldehyde to fix, rinse with PBS-T, add Fas.Fc dilution (the fusion molecule of the extracellular region of CD95 receptor protein molecule and the Fc segment of human IgG) to carry out binding reaction. Add enzyme-labeled antibody HRP-goat anti-human antibody and its substrate solution to develop color, and detect OD490nm after the reaction is terminated. Each clone had a wild-type phage negative control group and a blank control group without coating and primary antibody. Wherein, 1F4 clone is the ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 