Unlock instant, AI-driven research and patent intelligence for your innovation.

Polypeptide motif bound with human CD95 and its polypeptide

A CD95, peptidyl technology, applied in DNA, RNA, reagents or medicines, functional peptide field, can solve the problems of natural CD95L technical difficulties, unrealistic large-scale preparation, and murine problems, etc. Ease of mass production, great application potential, effect of enhancing activity

Inactive Publication Date: 2005-03-30
ARMY MEDICAL UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Purifying natural CD95L is not only technically difficult, but also unrealistic for large-scale preparation, so it is not suitable for clinical use. At present, only a small amount of human CD95L is used for scientific research experiments, and the price is expensive
The artificially prepared anti-CD95L antibody is a mouse anti-human CD95 antibody. It is a foreign protein antigen molecule for the human body, which will cause immune rejection. There is a problem of mouse origin and cannot be used in clinical practice.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polypeptide motif bound with human CD95 and its polypeptide
  • Polypeptide motif bound with human CD95 and its polypeptide
  • Polypeptide motif bound with human CD95 and its polypeptide

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0164] Embodiment 1 chemically synthesized polypeptide and its mass spectrometry detection

[0165] Peptides based on the characteristics of [Motif ID No: 1] or [Motif ID No: 2] can produce a lot of polypeptide sequences due to the combination, the following is only a polypeptide [SEQ ID No 2] based on [Motif ID No: 1] As an example, it is illustrated that the polypeptide can be obtained by the following method. The synthesis of the polypeptide [SEQ ID No 2] adopts a solid-phase synthesis method on a peptide synthesizer of ABI Company. The carrier resin used is HMP amino acid resin, the amount of amino acid is 1 mmol, ie amino acid:resin=4:1. According to the amino acid sequence of the polypeptide [SEQ ID No 2], the components of each amino acid are added in sequence for solid-phase synthesis. After the peptide is synthesized, according to the steps recommended by the PE company, add the synthesis after ice bath to 10ml cutting solution under ice bath conditions for cutting....

Embodiment 2

[0166] Embodiment 2 prepares fusion type polypeptide

[0167] 1) Synthesis of DNA encoding the polypeptide and primers

[0168] The DNA synthesizer uses solid-phase synthesis as a means, the carrier resin used is provided by ABI Company, and the operation steps are carried out according to the experimental manual provided by ABI Company. Both ends of the DNA sequence encoding the polypeptide are respectively designed as recognition sequences for EcoR I and BamH I endonucleases. Taking the fusion polypeptide of [SEQ ID No 2] polypeptide (fused with phage coat protein gp8) as an example, the construction, synthesis and secretion of the fusion polypeptide are described in detail. The procedure input during the synthesis of the DNA sequence [SEQ DNA No 2] encoding the polypeptide of [SEQ ID No 2] is as follows:

[0169] A: 5'GCGGGATCCGATGTTTTTTTTTTAGCTACGACGTTCGCGAATTCACCCG3'

[0170] B: Primer: 5'CGGGTGAATTC3'

[0171] After the synthesis was completed, the resin was removed ...

Embodiment 3

[0192] Example 3 Binding activity of fusion polypeptide to CD95 receptor protein (with Fas.Fc and cells)

[0193] According to the method of Liu Beiyi and others [Journal of Immunology, 14, 54-55, 1998], the recombinant phage clones displaying the polypeptide of the present invention on the surface were purified twice with PEG, and 1× of each clone was added to each well of the enzyme-linked plate. 1011 phage particles, wait for the water to evaporate at 37°C. After adding 10% formaldehyde to fix, rinse with PBS-T, add Fas.Fc dilution (the fusion molecule of the extracellular region of CD95 receptor protein molecule and the Fc segment of human IgG) to carry out binding reaction. Add enzyme-labeled antibody HRP-goat anti-human antibody and its substrate solution to develop color, and detect OD490nm after the reaction is terminated. Each clone had a wild-type phage negative control group and a blank control group without coating and primary antibody. Wherein, 1F4 clone is the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a polypeptide motif bound with human cytolemma surface film protein molecule CD95, its polypeptide, and the DNA sequence for coding said polypeptide. Said polypeptide can regulate the CD95 system to take part in the generation, development and recovery of multiple diseases, so it can be used to prepare the polypeptide medicines or their precursors to treat cancer, AIDS, etc, or in the field of organic transplant and transgenic animals.

Description

technical field [0001] The invention relates to a polypeptide motif combined with human cell membrane protein molecule CD95 and its polypeptide molecule, especially a functional polypeptide combined with the extracellular region of CD95. Furthermore, the present invention relates to DNA and RNA encoding these polypeptides. Because these polypeptides bind to the binding site of the extracellular region of CD95 molecules, they can block or induce cells to trigger their own death program to cause cell death. Therefore, the present invention also relates to the preparation of these polynucleotides and polypeptides that can be used for diagnosis and treatment and Application in reagents or medicines for diseases related to CD95 system. Background technique [0002] Since Wyllie first proposed the concept of programmed cell death in 1980 (Wyllie-AH, Glucocorticoid-induced thymocyte apoptosis is associated with endogenous endonuclease activation. Nature. 1980 Apr 10; 284(5756): 55...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K38/17A61P43/00C07K14/47C07K16/18C12N15/12C12Q1/68G01N33/68
Inventor 李华邹强朱锡华
Owner ARMY MEDICAL UNIV