Use of GABA transport protein inhibitor in preparing medicine for treating alcohol habituation and abuse
A technology of transporter and aminobutyric acid, which is applied in the direction of drug combination, pharmaceutical formula, organic active ingredients, etc., can solve the problems of no curative effect, and achieve the effects of avoiding side effects, broad development prospects, and avoiding excessive drinking
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Experimental study of acute and chronic alcohol intake leading to elevated activity of GABA transporters in the central nervous system
[0028] The experimental operation is as follows: (1) Add alcohol with a final concentration of 20% (v / v) in the normal drinking water of the mice, and the mice drink alcohol continuously for two months. These mice are the mice with chronic alcohol intake; Alcohol intake mice were intraperitoneally injected alcohol 2.4g / kg 15 minutes before the experiment, and the control group was injected with normal saline. (2) The mice were killed by neck dislocation, and the whole brain was quickly taken out, homogenized 12-15 times in homogenization buffer (0.32M sucrose, 10mM glucose, adjusted to pH 7.4 with Tris-HCl), and the tissue and homogenization buffer The weight ratio was 1:9, and the operation was carried out in an ice bath. (3) Centrifuge in a refrigerated centrifuge for 12 minutes at a speed of 1100g, take out the supernatant, and cen...
Embodiment 2
[0031] Experiments demonstrating whether alcohol interacts directly with GABA transporter I (GAT1) in vitro
[0032] The experimental operation is as follows: (1) CHO cells (G1 cells) stably expressing GABA transporter I were cultured in a 48-well cell culture plate, and replaced with serum-free medium 3 hours before the experiment. (2) Remove the medium, wash with phosphate buffered saline (PBS) three times, add 100 μl of Hank’s salt buffered solution (HBSS) containing 20 mM, 100 mM alcohol or no alcohol to each well, and place at room temperature for 10 minutes. (3) For the time curve, GABA and 3 H-GABA mixture ( 3 H-GABA is 4nM), reacted at room temperature for 2.5, 5, 10, 15, 20, 25 and 30 minutes; for the kinetic curve, the added concentration was 40nM, 100nM, 400nM, 1μM, 4μM, 10μM, 20μM, 30μM and 40 μM GABA and 3 H-GABA mixture ( 3 H-GABA was always kept at 4nM) and reacted at room temperature for 30 minutes. Use a vacuum pump (Shaoxing Satellite Medical Equipment M...
Embodiment 3
[0035] Acute and chronic alcohol intake prompts translocation of GABA transporter I from the synaptosome to the synaptosomal membrane
[0036] The experimental operation is as follows: 1. RT-PCR analysis (1) Chronic alcohol intake mice and control mice were killed by neck dislocation, the whole brain was quickly taken out, fully homogenized in Trizol reagent (GIBCO company), and RNA was extracted according to conventional methods. Methods Total RNA was extracted. (2) The total RNA sample was treated with RNase-free DNase at 37° C. for 45 minutes, and then extracted and purified with phenol / chloroform. (3) M-MLV reverse transcriptase (GIBCO company) was used for reverse transcription at 37° C. for 90 minutes to inactivate the reverse transcriptase, and the obtained sample was a cDNA sample. (4) Perform PCR reaction, the primers of GABA transporter I are: 5'ACCAAGCTTAGGCTGCAAAGCTGCTG3', the primers of 5'AGGCCTTTGAACATGGGCGCCAG3'GAPDH are: 5'ACGACCCCTTCATTGACC3', 5'AGACACCAGTAGA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
