Supercharge Your Innovation With Domain-Expert AI Agents!

Use of GABA transport protein inhibitor in preparing medicine for treating alcohol habituation and abuse

A technology of transporter and aminobutyric acid, which is applied in the direction of drug combination, pharmaceutical formula, organic active ingredients, etc., can solve the problems of no curative effect, and achieve the effects of avoiding side effects, broad development prospects, and avoiding excessive drinking

Inactive Publication Date: 2005-05-04
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] To sum up, the addiction and abuse of alcohol is a major social problem. People have been trying to find drugs for the treatment of alcohol addiction and abuse, but unfortunately there is no drug with satisfactory curative effect so far.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Use of GABA transport protein inhibitor in preparing medicine for treating alcohol habituation and abuse
  • Use of GABA transport protein inhibitor in preparing medicine for treating alcohol habituation and abuse
  • Use of GABA transport protein inhibitor in preparing medicine for treating alcohol habituation and abuse

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Experimental study of acute and chronic alcohol intake leading to elevated activity of GABA transporters in the central nervous system

[0028] The experimental operation is as follows: (1) Add alcohol with a final concentration of 20% (v / v) in the normal drinking water of the mice, and the mice drink alcohol continuously for two months. These mice are the mice with chronic alcohol intake; Alcohol intake mice were intraperitoneally injected alcohol 2.4g / kg 15 minutes before the experiment, and the control group was injected with normal saline. (2) The mice were killed by neck dislocation, and the whole brain was quickly taken out, homogenized 12-15 times in homogenization buffer (0.32M sucrose, 10mM glucose, adjusted to pH 7.4 with Tris-HCl), and the tissue and homogenization buffer The weight ratio was 1:9, and the operation was carried out in an ice bath. (3) Centrifuge in a refrigerated centrifuge for 12 minutes at a speed of 1100g, take out the supernatant, and cen...

Embodiment 2

[0031] Experiments demonstrating whether alcohol interacts directly with GABA transporter I (GAT1) in vitro

[0032] The experimental operation is as follows: (1) CHO cells (G1 cells) stably expressing GABA transporter I were cultured in a 48-well cell culture plate, and replaced with serum-free medium 3 hours before the experiment. (2) Remove the medium, wash with phosphate buffered saline (PBS) three times, add 100 μl of Hank’s salt buffered solution (HBSS) containing 20 mM, 100 mM alcohol or no alcohol to each well, and place at room temperature for 10 minutes. (3) For the time curve, GABA and 3 H-GABA mixture ( 3 H-GABA is 4nM), reacted at room temperature for 2.5, 5, 10, 15, 20, 25 and 30 minutes; for the kinetic curve, the added concentration was 40nM, 100nM, 400nM, 1μM, 4μM, 10μM, 20μM, 30μM and 40 μM GABA and 3 H-GABA mixture ( 3 H-GABA was always kept at 4nM) and reacted at room temperature for 30 minutes. Use a vacuum pump (Shaoxing Satellite Medical Equipment M...

Embodiment 3

[0035] Acute and chronic alcohol intake prompts translocation of GABA transporter I from the synaptosome to the synaptosomal membrane

[0036] The experimental operation is as follows: 1. RT-PCR analysis (1) Chronic alcohol intake mice and control mice were killed by neck dislocation, the whole brain was quickly taken out, fully homogenized in Trizol reagent (GIBCO company), and RNA was extracted according to conventional methods. Methods Total RNA was extracted. (2) The total RNA sample was treated with RNase-free DNase at 37° C. for 45 minutes, and then extracted and purified with phenol / chloroform. (3) M-MLV reverse transcriptase (GIBCO company) was used for reverse transcription at 37° C. for 90 minutes to inactivate the reverse transcriptase, and the obtained sample was a cDNA sample. (4) Perform PCR reaction, the primers of GABA transporter I are: 5'ACCAAGCTTAGGCTGCAAAGCTGCTG3', the primers of 5'AGGCCTTTGAACATGGGCGCCAG3'GAPDH are: 5'ACGACCCCTTCATTGACC3', 5'AGACACCAGTAGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The application of a gamma-aminobutyric acid (GABA) transporter inhibitor in the preparation of drugs for treating alcohol addiction and abuse. The inhibitors include all compounds that can inhibit the GABA transporter and make the body sensitive to alcohol, such as 3-piperidine carboxylic acid, tetrahydronicotinic acid, homo-β-proline, tetrahydropyridylisoxazolol (THPO), five Hydroazepin-isoxazolidine (THAO) and their derivatives, etc. Experimental results show that this type of compound that inhibits GABA transporters can sensitize the body to alcohol, thereby reducing the body's intake of alcohol. Therefore, this compound has clinical application value for treating alcohol addiction and abuse, and can be used for preparing drugs for treating alcohol addiction and abuse.

Description

technical field [0001] The invention relates to the field of biomedicine, specifically the application of gamma-aminobutyric acid (GABA) transporter inhibitors in the preparation of drugs for the treatment of alcohol addiction and abuse Background technique: [0002] Alcohol addiction and abuse has long been a major social problem, ranking third among mental disorders in the United States. Many people habitually use excessive drinking to relieve their sorrow when they encounter great mental stress, emotional tension or depression. Whether this behavior is transient or addictive, in short, excessive drinking is harmful to themselves and / or others It will be harmful, and in serious cases, it will endanger social stability and security. Long-term heavy drinking can lead to many diseases, such as liver cirrhosis, Wernicke-Korsakoff syndrome, various cancers, heart disease, fetal alcohol syndrome, etc. The occurrence of many accidents is also caused by drinking, causing economi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K31/197A61K31/42A61K31/44A61K31/445A61K31/455A61K31/55A61P25/30A61P25/32
Inventor 郭礼和胡佳华马映华杨纳费俭张懋弧
Owner SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More