Unlock instant, AI-driven research and patent intelligence for your innovation.

SiRNA and expression plasmid for inhibiting human bc1-2 gene expression and their use for preparing medicine

A technology of gene expression and bcl-2, applied in the field of siRNA, can solve the problems of prolonged cell survival time and no obvious increase in cell proliferation rate, and achieve the effect of inhibiting the occurrence and growth of tumors, less side effects, and strong specificity

Inactive Publication Date: 2005-12-28
SUZHOU SIXTH PHARMA PLANT OF JIANGSU WUZHONG PHARMA GROUP
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 1988, Vaux et al. transferred the Bcl-2 gene into bone marrow blast cells to make it highly expressed in the cells, resulting in the occurrence of tumors, and found that the survival time of the cells was significantly prolonged, but the proliferation rate of the cells did not increase significantly

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SiRNA and expression plasmid for inhibiting human bc1-2 gene expression and their use for preparing medicine
  • SiRNA and expression plasmid for inhibiting human bc1-2 gene expression and their use for preparing medicine
  • SiRNA and expression plasmid for inhibiting human bc1-2 gene expression and their use for preparing medicine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1: bcl-2 double-stranded RNA synthesized by siACE-RNAi inhibits the expression of bcl-2 gene in cancer cell HelaB2

[0038] The small double-stranded RNA (siRNA) synthesized by siACE-RNAi provided by the present invention is obtained according to the sequence of human bcl-2 mRNA found by the inventor in GenBank, and these RNA sequences must meet the following principles: Search for AA+N19+UU sequence or AA+N19 sequence starting from 75 bases after the start codon in the gene sequence, where N19 is any 19 mRNA nucleotide sequence. Generally, in the 21 nucleotides, the G+C ratio is about 50%, and the nucleotide sequence is not higher than 70% or not lower than 30%. The 21 nucleotide sequences that met the requirements were searched for homology of small nucleotide sequences in the NCBI database by BLAST to ensure that the targeted gene of interest was unique. The 3' ends of the designed 21-base sense RNA and antisense RNA were modified with 2-4 dT or 2-6 U to red...

Embodiment 2

[0047] Example 2: T 7 Double-stranded RNA synthesized by in vitro transcription inhibits bcl-2 gene expression in malignant melanoma A375 cells

[0048] 1. T 7 In vitro transcription to synthesize double-stranded RNA

[0049] The present invention provides T 7 The small double-stranded RNA (siRNA) synthesized in vitro is obtained according to the sequence of human bcl-2 mRNA found by the inventor in GenBank. These RNA sequences must conform to the following principles: the start codon in the gene sequence The last 75 bases start to look for AA+N19+UU sequence or AA+N19 sequence, where N19 is any 19 mRNA nucleotide sequence. Generally, in the 21 nucleotides, the G+C ratio is about 50%, and the nucleotide sequence is not higher than 70% or not lower than 30%. The 21 nucleotide sequences that meet the requirements are searched for homology of small nucleotide sequences in the NCBI database by BLAST to ensure that the targeted gene of interest is unique. The 3' ends of the de...

Embodiment 3

[0084] Example 3: Constructed hairpin double-stranded RNA inhibits the expression of bcl-2 gene in breast adenocarcinoma MCF-7 cells

[0085] One: Preparation of U6 promoter (human RNA polymerase III promoter)

[0086] 1. Design of U6 promoter PCR primers and PCR process

[0087] Primers:

[0088] 3' primer

[0089] AATCTGCAGAAAAAGCGGACCGAAGTCCGCTCTAGATGCATGCTCGAGGTCGTCCGGTGTTTCGTCCTTTCCAC

[0090] (SEQ ID NO. 7)

[0091] 5' primer CGCGGATCCAAGGTCGGGCAGGAAGAGGGC

[0092] (SEQ ID NO. 8)

[0093] PCR template: pAVU6+27 (see figure 2 )

[0094] The process of PCR

[0095] 94°C for 1 minute, 57°C for 1 minute, 72°C for 1 minute, after 35 cycles, 72°C for 10 minutes and storage at 4°C.

[0096] 2. The PCR product was electrophoresed on a 1% agarose gel. Under UV light, there was a very deep and bright band at 280bp, which was the U6 promoter band. Cut it out and use Qiagen gel recovery kit to recover the gel. Take 17 μl of the recovered DNA, add 2 μl of 10X restriction e...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention publishes a kind of especial siRNA and expression plasmid, which can control men's siRNA gene expression, and their application in curing or preventing knub. The invention can get a group of bcl-2 gene orders from geneBank by biotechnology and bases on the RNA interference technology. By this condition, a group of siRNA which can induce RNA interference and can be gotten. And quantitative siRNA by chemical composition can be composed to control bcl-2 gene expression and to control neoplasitic growth. The siRNA and the expression plasmid can be used to produce antineoplasitic that has high active, high specificity and little side effect.

Description

technical field [0001] The invention relates to a siRNA, in particular to a siRNA and an expression plasmid for inhibiting the expression of human bcl-2 gene and its application in pharmacy. Background technique [0002] Due to the problems of toxic and side effects or curative effect, the existing tumor therapy drugs still cannot control tumor growth and save the lives of many cancer patients. Most of the current tumor gene therapy focuses on the correction of defective genes in vivo by introducing foreign genes. This treatment has not yet been able to alter cancer cells' oncogenes. Since most tumors are caused by the overexpression of certain genes, the research on gene overexpression in tumor cells has gradually gained attention. The first is the antisense oligonucleotide gene therapy of tumors, but The dose used in this method is relatively large, so it is limited in the actual clinical treatment process. RNA interference technology is a new method for inhibiting gene ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K48/00A61P35/00C07H21/02C12N15/113C12N15/31C12N15/63
Inventor 傅更锋樊燕蓉郭丹肖祥华刘文华刘新卷徐根兴
Owner SUZHOU SIXTH PHARMA PLANT OF JIANGSU WUZHONG PHARMA GROUP
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More