SiRNA and expression plasmid for inhibiting human bc1-2 gene expression and their use for preparing medicine
A technology of gene expression and bcl-2, applied in the field of siRNA, can solve the problems of prolonged cell survival time and no obvious increase in cell proliferation rate, and achieve the effect of inhibiting the occurrence and growth of tumors, less side effects, and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1: bcl-2 double-stranded RNA synthesized by siACE-RNAi inhibits the expression of bcl-2 gene in cancer cell HelaB2
[0038] The small double-stranded RNA (siRNA) synthesized by siACE-RNAi provided by the present invention is obtained according to the sequence of human bcl-2 mRNA found by the inventor in GenBank, and these RNA sequences must meet the following principles: Search for AA+N19+UU sequence or AA+N19 sequence starting from 75 bases after the start codon in the gene sequence, where N19 is any 19 mRNA nucleotide sequence. Generally, in the 21 nucleotides, the G+C ratio is about 50%, and the nucleotide sequence is not higher than 70% or not lower than 30%. The 21 nucleotide sequences that met the requirements were searched for homology of small nucleotide sequences in the NCBI database by BLAST to ensure that the targeted gene of interest was unique. The 3' ends of the designed 21-base sense RNA and antisense RNA were modified with 2-4 dT or 2-6 U to red...
Embodiment 2
[0047] Example 2: T 7 Double-stranded RNA synthesized by in vitro transcription inhibits bcl-2 gene expression in malignant melanoma A375 cells
[0048] 1. T 7 In vitro transcription to synthesize double-stranded RNA
[0049] The present invention provides T 7 The small double-stranded RNA (siRNA) synthesized in vitro is obtained according to the sequence of human bcl-2 mRNA found by the inventor in GenBank. These RNA sequences must conform to the following principles: the start codon in the gene sequence The last 75 bases start to look for AA+N19+UU sequence or AA+N19 sequence, where N19 is any 19 mRNA nucleotide sequence. Generally, in the 21 nucleotides, the G+C ratio is about 50%, and the nucleotide sequence is not higher than 70% or not lower than 30%. The 21 nucleotide sequences that meet the requirements are searched for homology of small nucleotide sequences in the NCBI database by BLAST to ensure that the targeted gene of interest is unique. The 3' ends of the de...
Embodiment 3
[0084] Example 3: Constructed hairpin double-stranded RNA inhibits the expression of bcl-2 gene in breast adenocarcinoma MCF-7 cells
[0085] One: Preparation of U6 promoter (human RNA polymerase III promoter)
[0086] 1. Design of U6 promoter PCR primers and PCR process
[0087] Primers:
[0088] 3' primer
[0089] AATCTGCAGAAAAAGCGGACCGAAGTCCGCTCTAGATGCATGCTCGAGGTCGTCCGGTGTTTCGTCCTTTCCAC
[0090] (SEQ ID NO. 7)
[0091] 5' primer CGCGGATCCAAGGTCGGGCAGGAAGAGGGC
[0092] (SEQ ID NO. 8)
[0093] PCR template: pAVU6+27 (see figure 2 )
[0094] The process of PCR
[0095] 94°C for 1 minute, 57°C for 1 minute, 72°C for 1 minute, after 35 cycles, 72°C for 10 minutes and storage at 4°C.
[0096] 2. The PCR product was electrophoresed on a 1% agarose gel. Under UV light, there was a very deep and bright band at 280bp, which was the U6 promoter band. Cut it out and use Qiagen gel recovery kit to recover the gel. Take 17 μl of the recovered DNA, add 2 μl of 10X restriction e...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
