Method for preparing N-end acetylation modified thymosin alpha with recombined E. coli

A technology for recombining Escherichia coli and Escherichia coli, which is applied in the field of preparing N-acetylated proteins, and can solve the problems of no thymosin α and no acetylated modified products

Inactive Publication Date: 2004-09-29
INST OF BIOENG ACAD OF MILITARY MEDICAL SCI OF THE CHINESE
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Both thymosin α1 and prothymosin α have been expressed in Escherichia coli and purified, but there are no reports of N-terminal acetylation modification products (Wetzel et a1. Production of biologically active N a -Desacetylthymosin α1 in Escherichia coli through expression of a chemical synthesized gene. Biochemistry1980, 19, 6096-6104; Evstafieva AG et al. Overproduction in Escherichia coli, purification and properties of human prothymosin alpha. , and there is no report on the preparation of N-acetylated thymosin α by recombinant Escherichia coli

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing N-end acetylation modified thymosin alpha with recombined E. coli
  • Method for preparing N-end acetylation modified thymosin alpha with recombined E. coli
  • Method for preparing N-end acetylation modified thymosin alpha with recombined E. coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] The prothymosin alpha (Ile) of embodiment one N-terminal acetylation 13 ) preparation

[0035] 1. Expression of prothymosin α (Ile 13 ) construction of recombinant Escherichia coli

[0036] The pfu enzyme, endonuclease, ligase, kit, DH5α, etc. in the experiment were purchased from Shanghai Sangon Bioengineering Technology Service Co., Ltd. and Beijing Biotech Biogene Technology Co., Ltd.

[0037] Take four-month-old aborted human fetal thymus, use total RNA preparation kit, prepare total RNA according to the method provided by the kit, use RT-PCR kit, reverse transcribe mRNA into cDNA according to the method provided by the kit, and use the cDNA as Template from which prothymosin alpha (Ile 13 ) cDNA. The primers Prot1 and Prot2 used were synthesized with an oligonucleotide synthesizer.

[0038] Prot1: cggaattcatgtctgatgcagctgtagataccagctccgaaatcaccatcaaggactta

[0039] Prot2: cgggatccctagtcatccacgtcggtcttctg

[0040] The PCR method is:

[0041] Add 1 μl cDN...

Embodiment 2

[0055] Example two N-terminal acetylated thymosin α1 (Ile 13 ) Preparation of analogues

[0056] The N-terminal acetylated prothymosin α (Ile 13 ), dissolved in 2mol / L of hydroxylamine hydrochloride, then adjusted the pH to 9.0 with 4.5mol / L LiOH, kept at 45°C in a water bath for 4h, and the product was separated by RP-HPLC (using HP1050 high pressure liquid chromatography, C18 column (4.6×250mm , Dalian Institute of Chemical Physics, Chinese Academy of Sciences), liquid A is pure water containing 0.1% TFA; liquid B is chromatographically pure acetonitrile (Tianjin Siyou Company) containing 0.1% TFA, fine gradient: 0→50min, A100%→10% , B 0% → 90%.), collect each elution peak, after freeze-drying respectively, use Q-TOF2 mass spectrometry to analyze, take the peptide segment that molecular weight is about 3136, namely N-terminal acetylated thymosin α1 (Ile 13 )analog. It has the same sequence as the N-terminal 28 amino acid residues of Sequence 1 in the sequence listing, and...

Embodiment 3

[0057] Thymosin α11 (Ile 13 ) Preparation of analogues

[0058] The N-terminal acetylated prothymosin α (Thr 13 ), dissolved in 2mol / L of hydroxylamine hydrochloride, then adjusted the pH to 9.0 with 4.5mol / L LiOH, kept at 45°C in a water bath for 4h, and the product was separated by RP-HPLC (using HP1050 high pressure liquid chromatography, C18 column (4.6×250mm , Dalian Institute of Chemical Physics, Chinese Academy of Sciences), liquid A is pure water containing 0.1% TFA; liquid B is chromatographically pure acetonitrile (Tianjin Siyou Company) containing 0.1% TFA, fine gradient: 0→50min, A100%→10% , B 0% → 90%.), collect each elution peak, after freeze-drying respectively, use Q-TOF2 mass spectrometry to analyze, take the peptide segment that molecular weight is about 3818, namely N-terminal acetylated thymosin α11 (Ile 13 )analog. It has the same sequence as the 35 amino acid residues at the N-terminal of Sequence 1 in the sequence listing, and the N-terminal has bee...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses the preparation process of thynosin-alpha with acetylation modified N-end by using recombinant colibacillus. The preparation process includes obtaining thynosin-alpha gene, constructing recombinant expression vector containing thynosin-alpha, transforming prokaryotic cell, culturing prokaryotic cell and expressing thynosin-alpha, and separating and purifying thynosin-alpha with acetylation modified N-end. The present invention also discloses the process of utilizing recombinant colibacillus in preparing thynosin-alpha antigen with acetylation modified N-end and then cutting and separating to prepare thynosin-alpha-1 antigen with acetylation modified N-end, thynosin-alpha-2 antigen with acetylation modified N-end and similar matter. The thynosin-alpha with acetylation modified N-end has the functions of regulating immunity, cell proliferation, etc. and has wide application foreground in antivirus and antitumor.

Description

technical field [0001] The invention relates to a method for preparing N-acetylated protein by means of genetic engineering, in particular to a method for preparing thymosin α modified by N-terminal acetylation by recombinant Escherichia coli. Background technique [0002] Thymosin α is a family of immunomodulatory polypeptides with the same or similar N-terminal sequence, including prothymosin α, thymosin α1, thymosin α11 and so on. Thymosin α of different species is highly conserved. For convenience, the present invention only mentions human thymosin α, but thymosin α of other vertebrates is included. [0003] Human prothymosin α (proT) is an acidic protein composed of 109 amino acids, its content of glutamic acid and aspartic acid is greater than 30%, and its isoelectric point is 3.55. It can bind to histones and is widely distributed in tissues. In addition, its mRNA can also be detected in spleen, lymph, liver, kidney, testis, ovary, brain and other tissues. Prothymos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61P31/12A61P35/00C07K14/435C12N15/12C12N15/70C12P21/02
Inventor吴军马清钧唱韶红巩新
OwnerINST OF BIOENG ACAD OF MILITARY MEDICAL SCI OF THE CHINESE