Method for culturing chemical emasculation and seedless fruit plant
A plant and plant technology, applied in the field of plant genetic engineering, can solve problems such as safety restrictions on the application of transgenic technology, complex hybridization methods, and unfavorable plant growth and development
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0069] Example 1: Identification and cloning of rice resistance to sulfonylurea herbicides Bel. gene.
[0070] Sulfonylurea herbicides Nongdesi, Grass Buster, Bensulfuron-methyl, etc. are systemic conductive selective herbicides that are safe for rice. Rice is naturally resistant to these herbicides. To identify endogenous resistance genes to sulfonylurea herbicides in rice, cobalt 60 -Gamma ray irradiated dry seeds of rice variety W6154S with 350 gray, propagated to the M2 generation, harvested the M2 generation seeds by individual plants, kept half of the seeds of each single plant, and planted the half into one M3 generation row. At the seedling stage of the M3 generation, the heterocyclic herbicide bendazone solution at a concentration of one-thousandth was used for foliar spraying, and it was found that a line 8077S was specifically killed. Further tests showed that 8077S was also highly sensitive to the sulfonylurea herbicides Nondex, Grass Buster, and Bensulfuron-meth...
Embodiment 2
[0080] Example 2: Antisense RNA suppression of rice sulfonylurea resistance Bel. gene in male tissues and rice chemical maleicide.
[0081] According to a section of DNA sequence 1 of the Bel. gene obtained in Example 1, design and synthesize its antisense DNA sequence 2 as follows:
[0082] Sequence 2:
[0083] 5′-GCCCCAGTAGTCCTCGCCGCCGCCGCAGCCGCCGTAGCCGCAGCCG
[0084] CCGCCGCCGCCTCCGCCCCCTCGGCCGCCCCCCGACTACGCGTGCGCCGAC
[0085] GCGGAGGGGCAGCACGAGGAGAGGACGAGGGAGAAGAAGGAGCGGCCG
[0086] AAGAAGCCGAGGTAGGAGAAGTGGGTCCATTCGCTCCGCATCGCTGCCGC
[0087] TCTGG-3′
[0088] The expression cassette element commercially purchased from Gene Company Ltd was used to connect the rice Osg6B promoter (see the literature for the promoter sequence: Zhang Xiaoguo et al., Northwest Botanical Journal, 2000, 20(5): 701-706) and sequence 2, refer to The method in the literature (Zhang Xiaoguo et al., Acta Crops, Vol. 24(5): 629-634) was used to construct a plasmid, transform rice cells, screen pos...
Embodiment 3
[0089] Example 3: Antisense RNA suppression of rice hydroxylase gene and rice chemical maleicide.
[0090] According to the published literature research on the mechanism of rice resistance to sulfonylurea and bentazone, it is known that hydroxylase is one of the key enzymes in rice to metabolize sulfonylurea and bentazone into non-toxic products. Comparative analysis of 8077S and W6154S described in Example 1 shows that the content of hydroxylase in 8077S is much lower than that in W6154S. Therefore, it is inferred that the rice Bel. gene is related to the rice hydroxylase gene.
[0091] Combined with the experimental results that the Bel. gene is located on the third chromosome of rice, the published rice gene data was checked through the Internet, from the gene database of the National Biological Center of the United States (http: / / www.ncbi.nlm.nlh.gov) It was found that a complete gene sequence encoding prolyl hydroxylase α subunit similar to that of prolyl hydroxylase on...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com