Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for culturing chemical emasculation and seedless fruit plant

A plant and plant technology, applied in the field of plant genetic engineering, can solve problems such as safety restrictions on the application of transgenic technology, complex hybridization methods, and unfavorable plant growth and development

Inactive Publication Date: 2005-09-07
张集文
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Chinese patent application 99194700 discloses a method of using cytotoxic genes to terminate seed development early after pollination, but this method is irreversible, so in order to obtain the seeds needed for reproduction, a more complicated hybridization method must be used
The disadvantage of this technology is that it is necessary to use transgenic technology to introduce exogenous glyphosate-resistant genes into plants, which will produce heterologous proteins in plants, which is unfavorable to plant growth and development in many cases, and will also Restricted by the safety of the application of transgenic technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] Example 1: Identification and cloning of rice resistance to sulfonylurea herbicides Bel. gene.

[0070] Sulfonylurea herbicides Nongdesi, Grass Buster, Bensulfuron-methyl, etc. are systemic conductive selective herbicides that are safe for rice. Rice is naturally resistant to these herbicides. To identify endogenous resistance genes to sulfonylurea herbicides in rice, cobalt 60 -Gamma ray irradiated dry seeds of rice variety W6154S with 350 gray, propagated to the M2 generation, harvested the M2 generation seeds by individual plants, kept half of the seeds of each single plant, and planted the half into one M3 generation row. At the seedling stage of the M3 generation, the heterocyclic herbicide bendazone solution at a concentration of one-thousandth was used for foliar spraying, and it was found that a line 8077S was specifically killed. Further tests showed that 8077S was also highly sensitive to the sulfonylurea herbicides Nondex, Grass Buster, and Bensulfuron-meth...

Embodiment 2

[0080] Example 2: Antisense RNA suppression of rice sulfonylurea resistance Bel. gene in male tissues and rice chemical maleicide.

[0081] According to a section of DNA sequence 1 of the Bel. gene obtained in Example 1, design and synthesize its antisense DNA sequence 2 as follows:

[0082] Sequence 2:

[0083] 5′-GCCCCAGTAGTCCTCGCCGCCGCCGCAGCCGCCGTAGCCGCAGCCG

[0084] CCGCCGCCGCCTCCGCCCCCTCGGCCGCCCCCCGACTACGCGTGCGCCGAC

[0085] GCGGAGGGGCAGCACGAGGAGAGGACGAGGGAGAAGAAGGAGCGGCCG

[0086] AAGAAGCCGAGGTAGGAGAAGTGGGTCCATTCGCTCCGCATCGCTGCCGC

[0087] TCTGG-3′

[0088] The expression cassette element commercially purchased from Gene Company Ltd was used to connect the rice Osg6B promoter (see the literature for the promoter sequence: Zhang Xiaoguo et al., Northwest Botanical Journal, 2000, 20(5): 701-706) and sequence 2, refer to The method in the literature (Zhang Xiaoguo et al., Acta Crops, Vol. 24(5): 629-634) was used to construct a plasmid, transform rice cells, screen pos...

Embodiment 3

[0089] Example 3: Antisense RNA suppression of rice hydroxylase gene and rice chemical maleicide.

[0090] According to the published literature research on the mechanism of rice resistance to sulfonylurea and bentazone, it is known that hydroxylase is one of the key enzymes in rice to metabolize sulfonylurea and bentazone into non-toxic products. Comparative analysis of 8077S and W6154S described in Example 1 shows that the content of hydroxylase in 8077S is much lower than that in W6154S. Therefore, it is inferred that the rice Bel. gene is related to the rice hydroxylase gene.

[0091] Combined with the experimental results that the Bel. gene is located on the third chromosome of rice, the published rice gene data was checked through the Internet, from the gene database of the National Biological Center of the United States (http: / / www.ncbi.nlm.nlh.gov) It was found that a complete gene sequence encoding prolyl hydroxylase α subunit similar to that of prolyl hydroxylase on...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A method of using herbicide to kill or inhibit the special tissue and organ of the plant, comprising inhibiting the expression of the anti-herbicide gene in the special tissue and organ by using special promoter and antisense technique, then using inner suction conductive selective herbicide to realize the purpose of killing or inhibiting the special tissue and organ of the plant directionally. The product can be used for chemical male-killing, chemical top-killing, seedless watermelon production or prolonging the vegetative growth period according to different design.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering. In particular, the present invention is a method for targeted killing or inhibition of specific tissues or organs of plants with herbicides. Background technique [0002] In crop production, sometimes for some special requirements, it is necessary to kill or inhibit specific plant tissues or organs. For example, chemical castration for hybrid seed production is the use of chemical andricides to specifically kill the male tissue of a plant, or the male gametes of a plant. In terms of rice, several chemical andricides such as zinc methyl arsenate and sodium methyl arsenate have been developed, which were once used in China for hybrid seed production by chemical male killing (Hybrid Rice Reproduction, China Agricultural Press, 1999 1st edition, 2010, p. 312). In recent years, rice chemical andricides such as CHAIII (Acta Crops 2001, 27(6): 823-831) have been de...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A01H1/06A01H3/04C12N15/29C12N15/82
Inventor 张集文涂巨民
Owner 张集文
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More