Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Endo beta-1,3 glucanase gene and process for cloning the same

A technology of glucanase and gene, which is applied in the direction of genetic engineering, plant genetic improvement, botany equipment and methods, etc., can solve the problems of insufficient research work

Inactive Publication Date: 2005-11-23
JIANGNAN UNIV
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Scholars at home and abroad have done little research on the heterologous expression of endo-β-1,3-glucanase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Endo beta-1,3 glucanase gene and process for cloning the same
  • Endo beta-1,3 glucanase gene and process for cloning the same
  • Endo beta-1,3 glucanase gene and process for cloning the same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0162] Example 1 Cloning and transformation of endo-β-1,3 glucanase gene glu

[0163] P1 accggaattcatgtctccattgctggacgt

[0164] P2 cgtgaattcacgatgcctccggaggtgt

[0165] P3 cccggcggtatgtacacaactcgtggctgggaagcaaacc

[0166] P4 gttgtgtacataccgccgggaacat

[0167] P5 gatgctttgatgatgggtggttccgcttgcatggggagagg

[0168] P6 ccacccatcatcaaagcatctcg

[0169] Use BLAST software to search the microbial genome sequence with the amino acid sequence of the endo-β-1,3-glucanase. The open reading frame B23B10.170 coding product in the genome sequence of Neuromonas crassa may be the endo-β-1,3- Glucanase. This sequence was extracted from the genome sequence, and the GenScan software was used to analyze that the gene contained two introns, and the coded product of this gene was analyzed by the program Signa1PV2.0. It was identified as a secreted protein and the cleavage site of the signal peptide was determined. On the basis of the above analysis, primers P1 and P2 were designed, and the ...

Embodiment 2

[0170] Example 2 Expression of endo-β-1,3-glucanase gene glu

[0171] The recombinant plasmid pUC-glu was digested with EcoRI, and the gene glu fragment was obtained by gel recovery, and the gene glu was cloned into the EcoRI site of the plasmid pET28a to obtain the recombinant plasmid pET28a-glu in which the gene glu was inserted forward ( figure 2 ). The recombinant plasmid pET28a-glu was transformed into Escherichia coli DE3 (RILplus), and the gene recombinant strain EC-Glu was obtained. The recombinant strain EC-Glu was inoculated in 35mL LB medium, cultured at 37°C with shaking at 200r / min until the OD value was about 0.6, and induced by adding a final concentration of 0.5mmol / L isopropyl-β-D-galactoside for 4h. The cells were collected by centrifugation, and the cells were disrupted by adding lysozyme at a final concentration of 12.5 μg / mL to obtain a crude enzyme solution of endo-β-1,3 glucanase. The expression products were detected by SDS-PAGE ( image 3 ), the re...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an endo beta-1 glucanase gene and process for cloning, which belongs to the field of biological genetic engineering. the invention provides an endo-beta-1,3-glucanase glu originated from Neurospora crassa AS 3.1604, the nucleic acid sequence of the gene glu and the amino acid sequence of the corresponding protein, bacillus coli expression carrier pET28a-glu containing gene glu and the highly effective expression in bacillus coli, the invention can be applied to the construction of genetic engineering bacterium for the industrial production of the endo-beta-1,3-glucanase, and the increase of level and quality for endo-beta-1,3-glucanase by means of biofermentation.

Description

technical field [0001] An endo-beta-1,3 glucanase gene and its cloning method belong to the field of microbial genetic engineering. Background technique [0002] β-1,3-glucanase is divided into endo-β-1,3-glucanase (EC3.2.1.39) and exo-β-1,3-glucanase (EC3.2.1.58 ), widely distributed in bacteria, fungi and higher plants. Endo-β-1,3-glucanase specifically hydrolyzes high-molecular-weight glucan polymerized by β-1,3-glucosidic bonds by internal random cutting, and the product is oligosaccharide or glucose. [0003] The physiological function of β-1,3-glucanase varies depending on the source: in plants, although studies have shown that it plays a role in cell differentiation, it is mainly used as a defense system for pathogenic fungi; in bacteria Among them, it plays a nutritional role, because most bacteria do not contain β-1, 3-glucan; in fungi, β-1, 3-glucanase has many different functions. First, studies have shown that it plays a role in It has a certain physiological ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/56
Inventor 王正祥马骏双
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com