Watermelon anthrax bacteria detecting kit and its detecting method

A detection kit, anthracnose technology, applied in biological detection and biological fields, can solve the problems of low sensitivity, strong experience, disease monitoring and control of pathogenic bacteria onset and decay, etc., and achieve the effect of high sensitivity

Inactive Publication Date: 2006-08-09
EAST CHINA UNIV OF SCI & TECH
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The purpose of the present invention is to solve the problem in the prior art that the detection and identification of melon (class) anthracnose pathogens such as watermelon and muskmelon are mainly based on morphological characteristics. Timely monitor and control the spread and epidemic of pathogenic bacteria and the problem of disease and rot in the process of postharvest storage and transportation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Watermelon anthrax bacteria detecting kit and its detecting method
  • Watermelon anthrax bacteria detecting kit and its detecting method
  • Watermelon anthrax bacteria detecting kit and its detecting method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Embodiment 1, detection anthracnose in watermelon plant blade

[0059] a) Material

[0060] Specific primer sequences for Anthrax melonis were designed as follows:

[0061] First pair: upstream primer 5'CTTTGTGAACATACCTAACC 3'

[0062] Downstream primer 5'GGTTTTACGGCAGGAGTG 3'

[0063] Second pair: upstream primer 5'GCTGTCACTTTGTGGTGTG 3'

[0064] Downstream primer 5'TGTCGTAGCCCCATCTTGTC 3'

[0065] The above sequence was synthesized using a DNA synthesizer.

[0066] Prepare the reaction system of the kit as follows: 1mL detection solution includes: 120μl of 10×PCR reaction buffer, 2.0mM MgCl 2 80μl, 2.5mmol·L -1dNTPs 200 μl, 20 μM L -1 25 μl each of the two pairs of upstream and downstream primers, 600 units of Taq polymerase, and ultrapure water were added to 1 mL of the detection solution.

[0067] b) method:

[0068] 1) Obtain the crude DNA extract of anthracnose bacteria from leaves of plants such as watermelon or melon:

[0069] Take the plant leaves of...

Embodiment 2

[0072] Embodiment 2, detect anthrax bacteria in melon skin

[0073] The same reaction system as in Example 1a) was used.

[0074] Take melon skin tissue with small reddish-brown punctate lesions, add 25μl 0.5M NaOH to each gram of tissue, grind thoroughly in a mortar, transfer to a 1.5ml Eppendorf tube, centrifuge at 12000g for 5min, take 8μl supernatant and add 492 μl of 0.1 mM Tris (pH 8.0), after mixing, 1 μl was used directly for PCR reaction.

[0075] According to the method of Example 1, PCR amplification was carried out, and the results showed that two clear specific DNA bands were seen at 216bp and 442bp in the diseased melon skin (swimming lane 3-6) and the positive control (swimming lane 2). Healthy watermelon leaves (swimming lane 7), capsicum anthracnose (swimming lane 8), and cabbage anthracnose (swimming lane 9) have no bands (such as figure 2 shown).

Embodiment 3

[0076] Embodiment 3, detect the watermelon anthracnose bacteria in the watermelon field soil

[0077] Get 1g of watermelon anthracnose morbidity heavier field soil, add 10ml extracting solution (0.5mM glucose alcohol, 15% polyethylene glycol 6 000, 2% diethyl pyrocarbonate, 100mM EDTA and 50mM trimethylol aminomethane, pH 8.0), mixed for 5min, then added 600mg PVPP, 120μl 50mg·ml-1 lysozyme and 120μl 200mg·ml -1 β-glucanase, mix and place on ice for 2h. Then add cell lysis extract (4.0ml 4% SDS, 100mM EDTA, 60μl·ml -1 Proteinase K and 50mM Tris pH8.0), mixed and placed on ice for 18h. Centrifuge for 10 minutes, add 3M potassium acetate to the supernatant and place on ice for 2 hours, centrifuge to save the supernatant, add twice the volume of 100% ethanol to precipitate DNA, and dissolve in TE buffer. Take 1 μl for PCR reaction directly. The same reaction system as in Example 1a) was used.

[0078] Carry out PCR amplification according to the method for embodiment 1, as a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention provides a primer combination of melon anthracins used in a specific test sample and a PCR test reagent box containing said primer combination and a method for testing melon anthracins.

Description

technical field [0001] The present application relates to the field of biotechnology, especially the field of biological detection. Specifically, the application relates to a detection kit and a detection method for melon anthracnose bacteria. Background technique [0002] Cucurbitaceae plants are a large group of important plant groups in agricultural production. The common ones in agriculture include various melon crops, which have high economic value. But at the same time, it is a large class of crops with many types of diseases and serious damage. Anthracnose infecting Cucurbitaceae plants is one of the most serious diseases of Cucurbitaceae plants in the world, and it is also a major disease in major melon production areas in my country. Among them, watermelon suffered the most, followed by melon, cucumber, wax gourd, fleshy melon and bitter gourd, and pumpkin, zucchini and loofah were less serious. Cucurbit anthracnose is caused by the bacterium Colletotrichum orbic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04
Inventor王伟唐建辉魏鸿刚沈国敏李元广
OwnerEAST CHINA UNIV OF SCI & TECH