Watermelon anthrax bacteria detecting kit and its detecting method
A detection kit, anthracnose technology, applied in biological detection and biological fields, can solve the problems of low sensitivity, strong experience, disease monitoring and control of pathogenic bacteria onset and decay, etc., and achieve the effect of high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Embodiment 1, detection anthracnose in watermelon plant blade
[0059] a) Material
[0060] Specific primer sequences for Anthrax melonis were designed as follows:
[0061] First pair: upstream primer 5'CTTTGTGAACATACCTAACC 3'
[0062] Downstream primer 5'GGTTTTACGGCAGGAGTG 3'
[0063] Second pair: upstream primer 5'GCTGTCACTTTGTGGTGTG 3'
[0064] Downstream primer 5'TGTCGTAGCCCCATCTTGTC 3'
[0065] The above sequence was synthesized using a DNA synthesizer.
[0066] Prepare the reaction system of the kit as follows: 1mL detection solution includes: 120μl of 10×PCR reaction buffer, 2.0mM MgCl 2 80μl, 2.5mmol·L -1dNTPs 200 μl, 20 μM L -1 25 μl each of the two pairs of upstream and downstream primers, 600 units of Taq polymerase, and ultrapure water were added to 1 mL of the detection solution.
[0067] b) method:
[0068] 1) Obtain the crude DNA extract of anthracnose bacteria from leaves of plants such as watermelon or melon:
[0069] Take the plant leaves of...
Embodiment 2
[0072] Embodiment 2, detect anthrax bacteria in melon skin
[0073] The same reaction system as in Example 1a) was used.
[0074] Take melon skin tissue with small reddish-brown punctate lesions, add 25μl 0.5M NaOH to each gram of tissue, grind thoroughly in a mortar, transfer to a 1.5ml Eppendorf tube, centrifuge at 12000g for 5min, take 8μl supernatant and add 492 μl of 0.1 mM Tris (pH 8.0), after mixing, 1 μl was used directly for PCR reaction.
[0075] According to the method of Example 1, PCR amplification was carried out, and the results showed that two clear specific DNA bands were seen at 216bp and 442bp in the diseased melon skin (swimming lane 3-6) and the positive control (swimming lane 2). Healthy watermelon leaves (swimming lane 7), capsicum anthracnose (swimming lane 8), and cabbage anthracnose (swimming lane 9) have no bands (such as figure 2 shown).
Embodiment 3
[0076] Embodiment 3, detect the watermelon anthracnose bacteria in the watermelon field soil
[0077] Get 1g of watermelon anthracnose morbidity heavier field soil, add 10ml extracting solution (0.5mM glucose alcohol, 15% polyethylene glycol 6 000, 2% diethyl pyrocarbonate, 100mM EDTA and 50mM trimethylol aminomethane, pH 8.0), mixed for 5min, then added 600mg PVPP, 120μl 50mg·ml-1 lysozyme and 120μl 200mg·ml -1 β-glucanase, mix and place on ice for 2h. Then add cell lysis extract (4.0ml 4% SDS, 100mM EDTA, 60μl·ml -1 Proteinase K and 50mM Tris pH8.0), mixed and placed on ice for 18h. Centrifuge for 10 minutes, add 3M potassium acetate to the supernatant and place on ice for 2 hours, centrifuge to save the supernatant, add twice the volume of 100% ethanol to precipitate DNA, and dissolve in TE buffer. Take 1 μl for PCR reaction directly. The same reaction system as in Example 1a) was used.
[0078] Carry out PCR amplification according to the method for embodiment 1, as a...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 