Unlock instant, AI-driven research and patent intelligence for your innovation.

Axon regeneration promoter

A technology for axon regeneration and promoters, which is applied in the field of axon regeneration promoters, and can solve problems such as inability to promote spinal cord regeneration and inability to regenerate central nervous system axons

Inactive Publication Date: 2007-04-18
BIOCLUES
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, by studying mice in which various inhibitory substances were knocked out, it was found that only removal of the above-mentioned inhibitory substances could not regenerate central nerve axons (Non-Patent Documents 18-22)
It has also been reported that depletion of functional p75NTR or administration of soluble p75N-Fc does not promote regeneration of the injured spinal cord (Non-Patent Document 23)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Axon regeneration promoter
  • Axon regeneration promoter
  • Axon regeneration promoter

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0055] Preparation of antibody-producing cells

[0056] Cells producing antibodies that bind to RGM-like proteins can be obtained by methods well known in the art. Animals are immunized with RGM-like proteins as allergens, the resulting immune cells are collected, fused with myeloid tumor cells, and hybridomas producing antibodies are cloned. In more detail, first, an RGM-like protein is prepared as an antigen. The commercially available brain cDNA library contains the cDNA of the RGM-like protein, so the amplified product of the gene can be easily obtained by PCR using the commercially available brain cDNA library as a template, and the gene can be inserted into an appropriate vector to achieve recombination. Generates RGM-like proteins. Then, the above-prepared RGM-like protein is used as an antigen and administered subcutaneously, intravenously or intraperitoneally to animals. Mammals such as mice, rats, hamsters, rabbits, and goats can be used as immunized animals. Pre...

Embodiment 1

[0087] Cloning of RGM-like proteins

[0088] Using the amino acid sequence of chicken embryo RGM (Non-Patent Document 24) as a query sequence, a BLAST search of the GenBank database was performed. The result was identified as the rat cDNA with the accession number XM_218791 (Rattus norvegicus). The deduced amino acid sequence has 79% homology with chicken embryo RGM-like protein, so XM_218791 was named rat RGM-like protein. The full-length rat RGM-like protein cDNA was isolated from a mature rat brain cDNA library by PCR. The base sequence of the forward primer used is agtggtaacaggccgagctggatgg (SEQ ID NO: 5), the base sequence of the reverse primer is ccacaaccttgtcgcgtgcactaat (SEQ ID NO: 6), and the denaturation step at 95°C for 30 seconds and annealing at 55°C for 30 seconds were repeated 25 times. step, and an elongation step of 3 minutes and 30 seconds at 72°C. The encoded protein consists of 431 amino acid residues. Based on Non-Patent Document 24, since native rat R...

Embodiment 2

[0119] 1. Method

[0120] (1) Surgery

[0121] Anesthetized (sodium pentobarbital, 40 mg / kg) male Wistar rats (200-250 g) were subjected to T9 / 10 laminectomy at the vertebral level to expose the spinal cord. A No. 11 blade was used to cut to a depth of 1.8 mm in the dorsal portion of the spinal cord. By histological examination, in all animals, the injury described above severed all dorsal corticospinal tract (CST) fibers in the posterior column, as well as the lateral corticospinal tract, extending beyond the central canal. Immediately after the half of the spinal cord was cut, it was assembled to be full of control antibody (8 mice, 22.3 μg / kg day, 2 weeks) or the anti-RGM-like protein antibody prepared in Example 1 (8 mice, 22.3 μg / kg day, 2 weeks ) osmotic pressure micropump (200 μL solution, 0.5 μL / hour, delivery for 14 days) (manufactured by Durect, Cupertino, California, USA). The micropump was placed under the skin on the back of the animal, and the silicone tube co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

An axon regeneration promoter which contains an RGM-like protein inhibitor as the active ingredient. Examples of the RGM-like protein inhibitor include anti-RGM-like protein antibodies, RGM-like protein inhibitors such as Y27632 and antisense nucleic acids and double-stranded DNAs capable of inhibiting the transcription or translation of RGM-like proteins. This axon regeneration promoter is efficacious in the regeneration of a central nerve axon and thus contributes to, for example, the treatment of a patient suffering from injury in the central nerve system such as the spinal cord by a traffic accident, cerebrovascular disorder, etc.

Description

technical field [0001] The present invention relates to an axon regeneration promoting agent capable of promoting axon regeneration of nerve cells, particularly nerve cells of the central nervous system. Background technique [0002] If the central nervous system such as the spinal cord is injured by traffic accidents or damaged by cerebrovascular disorders, the function of the nerves is lost and cannot be regenerated. And peripheral nerves can regenerate. Injury to the central nervous system often results in partial or complete paralysis because it cannot regenerate once damaged. Therefore, regeneration of the damaged central nervous system is an important topic in the medical field. [0003] However, since the axons of the adult central nervous system can be regenerated by grafting of peripheral nerves (Non-Patent Document 1), it has been suggested that the main reason why the adult central nervous system does not regenerate is the local environment surrounding nerve cel...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K45/00A61K31/4409A61K39/395A61P25/00A61P25/28
Inventor 山下俊英羽田克彦
Owner BIOCLUES