Long-lasting recombinant human red blood cell growth factor fusion protein and method

A growth factor and fusion protein technology, which is applied in the field of long-acting recombinant human erythrocyte growth factor fusion protein and its preparation, and can solve the problems of low activity and reducing the number of drugs

Inactive Publication Date: 2007-07-11
李欣越
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The present invention provides a long-acting recombinant human erythrocyte growth factor fusion protein and a method for enhancing biological activity. And the disadvantage of low activity, in order to increase the half-life of erythrocyte growth factor, increase its residence time in the blood to exert a longer effect, and prolong the biological activity of the protein, thereby reducing the number of medications; thus providing a biologically active Long-acting recombinant human erythrocyte growth factor fusion protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Long-lasting recombinant human red blood cell growth factor fusion protein and method
  • Long-lasting recombinant human red blood cell growth factor fusion protein and method
  • Long-lasting recombinant human red blood cell growth factor fusion protein and method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0077] Example 1 The connecting fragment used in this example is a connecting peptide, the primary structure of the connecting peptide sequence, that is, the protein sequence connecting the dimer / trimer, is a connecting sequence of 9-20 amino acids, with these connecting sequences All amino acids can be used, and a sequence shown in Figure 7 is used in this example.

[0078] Design and preparation of primer oligodeoxyribonucleic acid:

[0079] P1: 5'TGGGGGTGCACGAATGTCCTGC 3'

[0080] P1 starts from the EPO gene initiation factor, including the signal peptide chain.

[0081] P2: 5'TCATCTGTCCCCTGTCCTGCAGG3'

[0082] P2 is an oligodeoxyribonucleic acid complementary to the 3' end, together with P1, by PCR,

[0083] Amplification and cloning of full-length (protein coding) EPO cDNA. The subsequent subcloning and duplex / trimer construction will be based on this plasmid.

[0084] P3: 5'AAGCTAGGATCCATGGGGGTGCACGAATGTCCTGC 3'

[0085] The latter part of P3 is consistent with the...

Embodiment 2

[0093] Example 2 Screening and determination of LINKER sequences used in EPO-EPO and EPO-EPO-EPO:

[0094] After a series of pre-tests and tests, the following connecting peptide sequences were determined, including but not limited to the following sequences:

[0095] Gly-Gly-Ser-Gly-Ala-Ala-Ser-Gly-Gly;

[0096] Gly-Gly-Ser-Gly-Ala-Ala-Ser-Gly-Ser-Ser;

[0097] Gly-Gly-Gly-Gly-Ala-Ala-Ser-Gly-Ser-Ser-Ala;

[0098] Gly-Gly-Gly-Gly-Ala-Ala-Ser-Gly-Ser-Ser-Ala-Gly;

[0099] Gly-Gly-Ser-Gly-Gly-Gly-Ser-Ala-Ala-Gly-Gly-Ser-Gly;

[0100] Gly-Gly-Ser-Gly-Gly-Gly-Ser-Ala-Ala-Gly-Gly-Ser-Gly-Gly;

[0101] Gly-Gly-Gly-Gly-Ala-Ala-Ser-Gly-Ser-Ser-Ala-Gly-Ser-Ala-Ala;

[0102] Gly-Gly-Ser-Gly-Ala-Ala-Ser-Gly-Ser-Ser-Ala-Gly-Gly-Ser-Gly-Gly;

[0103] Gly-Gly-Ser-Gly-Gly-Gly-Ser-Ala-Ala-Gly-Gly-Ser-Gly-Gly-Ser-Ala-Ala;

[0104] Gly-Gly-Ser-Gly-Gly-Gly-Ser-Ala-Ala-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Ser-Ser-Ala-Gly;

[0105] Gly-Gly-Scr-Gly-Gly-Gly-Ser-Ala-Ala-Gly-Gly-Ser-Gly-Gly-Ser-Gly-Se...

Embodiment 3

[0108] Embodiment 3 EPO, the determination of the full-length nucleotide sequence of EPO-EPO and EPO-EPO-EPO fusion gene:

[0109] In order to obtain the EPO gene, EPO-EPO and EPO-EPO-EPO fusion genes, the cDNA and the modified sequences were subcloned and terminally modified, and the nucleotides of each cDNA and the modified fusion genes were carried out by conventional methods. Sequence determination (see Example 1, Figure 2, Figure 3, Figure 4 for details).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fusing protein of long-effective recombinant human exoerythrocytic growing factor, which is characterized by the following: connecting two or three same genes of exoerythrocytic growing factor through one or two sections; constructing mammal expression plasmid; transmitting the plasmid in the mammal cell to express; lengthening the reserving time in the biological body for protein; reducing drug feeding times; improving the clinic practical value.

Description

technical field [0001] The invention relates to a long-acting recombinant human erythrocyte growth factor fusion protein with enhanced biological activity and a preparation method thereof. Background technique [0002] Erythrocyte growth factor is an important stimulating factor for the growth and differentiation of red blood cells. Its function is to regulate and promote the growth and differentiation of immature red blood cells. It can promote the differentiation of late BFU-E (Burst Forming Units-Erythrocytes) and CFU-E (Colony Forming units-Erythrocytes) function, and the hemoglobin it synthesizes becomes mature red blood cells. It also promotes early release of reticulocytes and stimulates bone marrow megakaryocytes. [0003] Erythrocyte growth factor has been widely used clinically to treat anemia caused by kidney disease, anemia caused by chemotherapy in tumor patients, and hemorrhage caused by trauma, which can stimulate the patient's own hematopoietic function and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C07K14/475C12N15/62C12N15/09A61K38/16A61P13/12A61P35/02
Inventor李洪兴
Owner李欣越