Alpha-synuclein super-mutants accelerate alpha-synuclein aggregation

a technology of alpha-synuclein and super-mutants, which is applied in the field of alpha-synuclein super-mutants and acceleration of alpha-synuclein aggregation, can solve the problems of slowing down the pace of such ultilitarian activities, tension which can produce aches and pains in the back, neck, shoulders, temples, etc., and achieves high throughput screening

Inactive Publication Date: 2002-10-17
AMGEN INC
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

0010] Also provided is an in vitro aggregation assay which can be used to evaluate .alpha.-synuclein super-mutants, and whic...

Problems solved by technology

Bradykinesia, a slowness or "poverty" of movement, slows the pace of such ultilitarian activities as walking and eating, and also makes movements that were once second nature take on a ponderous and deliberate quality.
Rigidity is caused by the inability of muscles to relax as opposing muscle groups contract, causing tension which can produce aches and pains in the back, neck, shoulders, temples, or chest.
Despite these reports and other extensive PD research conducted to date, there is still no known cure for PD.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Alpha-synuclein super-mutants accelerate alpha-synuclein aggregation
  • Alpha-synuclein super-mutants accelerate alpha-synuclein aggregation
  • Alpha-synuclein super-mutants accelerate alpha-synuclein aggregation

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0029] This example describes the cloning and bacterial expression of the wild type .alpha.-synuclein protein and various naturally occurring and artificial .alpha.-synuclein mutant forms.

[0030] A 536 basepair human .alpha.-synuclein cDNA was obtained by PCR amplification from an adult human brain cDNA library using primers corresponding to nucleotides 20-42 and 532-556, respectively, of the published sequence; Ueda et al., Proc. Natl. Aca. Sci. USA, 90:11282-11286 (1993). PCR based site directed mutagenesis of this sequence was then used to generate the mutant forms A53T, A30P, A53T / A30P, E83Q / A90V, H50Y / A53T, and H50T / A53T / A76T. For bacterial expression all forms were amplified using the following primers:

1 TGTGGTCTAGAAGGAGGAATAACATATGGATGTATTCATGAAAG (SEQ ID NO: 5) and GTCTGTCAAAGGCCAAGGAGGGTGTTGTG GGGACCGCGGCTCGAGATTAGGCTTCAGGTTCGTAGTCTTGATA (SEQ ID NO: 6) ACCTTCCTCA

[0031] to alter 3 codons near the 5' end and 1 codon near the 3' end to more highly utilized E. coli codons. The r...

example 2

[0032] This example describes the purification and characterization of the various .alpha.-synuclein forms prepared in Example 1.

[0033] E. coli cell paste was homogenized in 20 mM Tris, 100 mM NaCl, pH 7.5, with protease inhibitor cocktail Complete (Boehringer Mannheim). Cells in suspension were broken by passaging through a Microfluidizer and a clarified lysate supernatant was collected after centrifugation at 18,000.times.g for 45 minutes. E. coli contaminating proteins were then acid precipitated by adjusting the pH of the lysate supernatant to pH 3.5 using 10% (v / v) of acetic acid, stirring for 20-30 minutes, and then centrifuging the mixture for 1 hour at 27,000.times.g. The pH of the resulting supernatant was then adjusted to pH 7.5 using 10% (v / v) of acetic acid, and the sample applied to a Q-Sepharose Fast Flow column (Pharmacia) equilibrated in 20 mM Tris, pH 7.5. The .alpha.-synuclein protein was then eluted from the column using a NaCl gradient from 0 to 300 mM NaCl in 20...

example 3

[0036] This example describes the in vitro aggregation experiments first performed on the wild type .alpha.-synuclein, the naturally occurring A53T mutant, the naturally occurring A30P mutant, and the A30P / A53T mutant forms prepared in Example 2.

[0037] Purified samples of the four forms were concentrated to >7 mg / ml in Tris-buffered saline (20 mM Tris, 200 mM NaCl, pH 7.5)(TBS)+0.05% sodium azide and then sterile filtered through 0.22 micron filters to remove any particulate matter. Each of the filtrates was then adjusted to a final concentration in the range of .about.7 mg / ml in TBS+0.05% sodium azide and incubated over several days at room temperature, 4.degree. C., and 37.degree. C. in parafilm sealed, 1.5 ml ultracentrifuge tubes (Beckman). During the time frame of the experiment, no aggregates formed when incubated at room temperature or at 4.degree. C.

[0038] After incubation for several days at 37.degree. C., all samples began to form insoluble aggregates that could be precipi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Aggregationaaaaaaaaaa
Login to View More

Abstract

Parkinson's disease (PD) is a neurodegenerative disorder which is pathologically characterized by the presence of intracytoplasmic Lewy bodies, the major component of which are filaments consisting of .alpha.-synuclein. The present invention provides .alpha.-synuclein mutations which accelerate .alpha.-synuclein aggregation and can thus be utilized for transgenic animal production and generation of the first progressive PD model. Also provided is an in vitro aggregation assay which can be utilized to identify .alpha.-synuclein nucleation inhibitors for the treatment of PD.

Description

CROSS REFERENCE TO RELATED APPLICATIONS[0001] This application is a divisional of U.S. patent application Ser. No. 09 / 612,795 filed Jul. 10, 2000 which is a divisional of U.S. patent application serial no. 09 / 405,035 filed Sep. 24, 1999 which claims the benefit to U.S. provisional application serial no. 60 / 101,862 filed Sep. 25, 1998 which are incorporated by reference herein.BACKGROUND OF THE INVENTION[0002] Parkinson's disease (PD) is a progressive, degenerative neurologic disorder which usually occurs in late mid-life, and is the second most common neurodegenerative disorder, after Alzheimer's disease. PD predominantly affects dopaminergic neurons in the nigrastriatal system but also several other regions of the brain, and is clinically characterized by bradykinesia, tremor, and rigidity.[0003] Bradykinesia, a slowness or "poverty" of movement, slows the pace of such ultilitarian activities as walking and eating, and also makes movements that were once second nature take on a pon...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A01K67/027A61K38/00A61K45/00A61P25/16A61P43/00C07K14/47C12N15/09C12N15/12G01N33/15G01N33/50G01N33/566G01N37/00
CPCA01K67/0275C07K14/47A61K38/00A01K2217/05A61P25/16A61P43/00
InventorBIERE, ANJA LEONACITRON, MARTIN
OwnerAMGEN INC