Unlock instant, AI-driven research and patent intelligence for your innovation.

VEGF-related protein

a vegf and kinase technology, applied in the direction of peptide/protein ingredients, depsipeptides, fusion polypeptides, etc., can solve the problems of loss of biological activity and possible immunogenicity changes, low product yield, and complex recovery of genomic dna encoding vrp

Inactive Publication Date: 2004-10-28
GENENTECH INC
View PDF40 Cites 42 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

VRP effectively stimulates the phosphorylation of the Flt4 receptor, enhancing vascular or lymph endothelial cell growth and promoting angiogenesis, making it useful for treating vascular traumas, wounds, and disorders related to vascular endothelial cell growth.

Problems solved by technology

For example, a vector is cloned in E. coli and then the same vector is transfected into yeast or mammalian cells for expression even though it is not capable of replicating independently of the host cell chromosome.
However, the recovery of genomic DNA encoding VRP is more complex than that of an exogenously replicated vector because restriction enzyme digestion is required to excise the VRP DNA.
When encapsulated proteins remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 37.degree. C., resulting in a loss of biological activity and possible changes in immunogenicity.
The purification of the correct molecule, which is usually done by affinity chromatography steps, is rather cumbersome, and the product yields are low.
Age-related macular degeneration (AMD) is a leading cause of severe visual loss in the elderly population.
When encapsulated VRP antibodies remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 37.degree. C., resulting in a loss of biological activity and possible changes in immunogenicity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • VEGF-related protein
  • VEGF-related protein
  • VEGF-related protein

Examples

Experimental program
Comparison scheme
Effect test

example 2

Receptor IgG Fusion Proteins, Flt4 / IgG Antiserum, and G61 FACS Analysis

[0249] Flt1 / IgG (Park et al., supra), Flk1 / IgG (Park et al., supra), Rse / IgG (Godowski et al., Cell, 82: 355-358 [1995]), and Htk / IgG (Bennett et al., J. Biol. Chem., 269: 14211-14218 [1994]) were produced as described in these references. For Flt4 / IgG, DNA encoding the extracellular domain of the Flt4 receptor (amino acids 1-775) was spliced to the Fc region of a human IgG heavy chain at the unique BstEII site in the plasmid pBSSK-Fc (pBSSK-CH2CH3). Bennett et al., J. Biol. Chem., 266: 23060-23067 (1991). The open reading frame encoding Flt4 / IgG was cloned in the mammalian expression vector pRK5 (Suva et al., Science, 237: 893-896 [1987]) to yield the plasmid pRK5.tk1ig1.1. This plasmid was transfected by electroporation (Janssen et al., supra) into 293 cells (ATCC CRL 1651), and after 3-4 days, Flt4 / IgG was purified from the serum-free conditioned medium with protein A agarose (Calbiochem). Flt4 antiserum was g...

example 3

Isolation of cDNA Clones Encoding Human VRP

[0252] A cDNA library was prepared from polyA+RNA isolated as described in Cathala et al., DNA: 2: 329-335 (1983) and Aviv and Leder, Proc. Natl. Acad. Sci. USA, 69: 1408-1412 (1972) from the human glioma cell line, G61. Hamel et al., supra. cDNA was prepared from this RNA with reagents from GIBCO / BRL (SuperScript) and cloned in the plasmid pRK5B (Holmes et al., Science, 253: 1278-1280 [1991]) digested with XhoI and NotI. Clones encoding VRP were isolated by screening the cDNA library with synthetic oligonucleotide probes based on an EST sequence (GenBank locus HSC1WF111), which showed a reasonable match to VEGF. The EST sequence of HSC1WF111 is 299 bp and is 36% identical to VEGF over 50 residues, including an 11 of 13 residue match beginning at VEGF amino acid 56. The sequence is as follows:

1 5'- (SEQ ID NO: 6) CCGTCTACAGATGTGGGGGTTGCTGCAA-TAGTGAGGGGCTGCAGTGCATG AACACCAGCACGAGCTACCTCAGNAAGACGTTATT-TGAAATTACAGTGCC TCTCTCTCAAGGCCCCAAACCAGTA...

example 4

Receptor IgG Precipitation of .sup.35S-Labeled VRP

[0260] To determine whether VRP is a ligand for Flt4, expression plasmids containing the VH1.4 cDNA clone, as well as control plasmids (the expression vector alone or with VEGF or PlGF DNA), were transfected into COS7 cells and the proteins labeled with .sup.35S amino acids. Conditioned media from these cells was precipatated with Flt4 / IgG and Flk1 / IgG. Specifically, the VRP expression plasmid, pRK.vh1.4.2, was constructed by deleting about 360 bp of 5' untranslated sequence (5' of the AgeI site (FIG. 3A) from VH1.4). This DNA and control plasmids encoding VEGF.sub.165 (Houck et al., Mol. Endocrinol., 5: 1806-1814 [1991]), PlGF.sub.152 (Park et al., supra), or the vector alone (pRK5; Suva et al., supra) were transfected into COS7 cells with DEAE-dextran. Janssen et al., supra. Two days after transfection, the cells were pulse-labeled in 10-cm dishes for 5 hours with 5 mL of methionine- and cysteine-free DMEM supplemented with 100 .mu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
concentrationaaaaaaaaaa
concentrationsaaaaaaaaaa
Login to View More

Abstract

A human VEGF-related protein (VRP) has been identified and isolated that binds to, and stimulates the phosphorylation of, the receptor tyrosine kinase Flt4. The VRP is postulated to be a third member of the VEGF protein family. Also provided are antibodies that bind to VRP and neutralize a biological activity of VRP, compositions containing the VRP or antibody, methods of use, chimeric polypeptides, and a signal polypeptide for VRP.

Description

PRIORITY OF INVENTION[0001] This application is a divisional of pending U.S. patent application Ser. No. 09 / 313,299, filed on May 17, 1999, which is a divisional application of U.S. patent application Ser. No. 08 / 706,054, filed on Aug. 30, 1996, now U.S. Pat. No. 6,451,764, which claims the benefit of U.S. Provisional Application Serial No. 60 / 003,491, filed on Sep. 8, 1995. All of these applications are hereby expressly incorporated by reference.[0002] 1. Field of the Invention[0003] The present invention pertains generally to a receptor protein tyrosine kinase (rPTK) ligand. More particularly, the invention relates to a novel ligand, designated VEGF-related protein (VRP) or VH1, which binds to, and stimulates the phosphorylation of, the Flt4 tyrosine kinase receptor (also known as the Sal-S 1 receptor) and the isolation and recombinant production of the same.[0004] 2. Description of Related Art[0005] The formation of new blood vessels either from differentiating endothelial cells ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): A61K31/00A61K38/00G01N33/53A61K48/00A61P9/00A61P17/00A61P17/02C07K14/52C07K14/71C07K16/24C07K19/00C12N5/00C12N15/00C12N15/19C12P21/02C12R1/91G01N33/577
CPCA61K38/00C07K14/52C07K14/71C07K16/22C07K2319/00C07K2319/30A61P11/00A61P13/12A61P17/00A61P17/02A61P17/06A61P19/02A61P27/02A61P27/06A61P29/00A61P35/00A61P35/04A61P43/00A61P5/14A61P7/00A61P7/10A61P9/00A61P9/10A61P9/14A61P3/10
Inventor LEE, JAMESWOOD, WILLIAM
Owner GENENTECH INC