Mutations associated with iron disorders
a technology of mutations and iron disorders, applied in the field of mutations associated with iron disorders, can solve the problems of tissue damage and functional impairment of organs, and achieve the effect of high iron absorption and elevated fasting transferrin saturation level
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
example 1
Selection and Characterization of Subjects
[0038] All individuals studied were Caucasians, 18 years of age or older, and from central Alabama. Twenty probands were identified that were either heterozygous for C282Y or H63D, or lacked these mutations. Hemochromatosis is typically diagnosed by detecting elevated saturation of transferrin, with elevated serum ferritin levels, combined with liver biopsy. Each proband patient described below was previously diagnosed to have hemochromatosis by the working diagnostic criterion for hemochromatosis of the American College of Pathologists (elevated fasting transferrin saturation of greater than 60% saturation for males and greater than 50% saturation for females) on at least two occasions in the absence of other known causes. Probands were interviewed regarding their general medical history, diet (including estimated iron content and ethanol consumption), medicinal iron use, receipt of blood transfusion, prior significant hemorrhage, blood do...
example 2
HFE Gene Analysis
[0039] PCR amplification was used to detect mutations. Genomic DNA was prepared from peripheral blood buffy coat or saliva using the QIAmpBlood Kit (QIAGEN, Valencia, Calif.) or FTA Paper and FTA purification reagent (Fitzco Inc., Maple Plain, Minn.), respectively. Fragments were amplified from genomic DNA using eLONGase (Life Technologies, Gaithersburg, Md.) or HotStarTaq DNA polymerase (QIAGEN, Valencia, Calif.). Primers used to amplify each exon are shown in Table 3.
TABLE 4Human HFE genomic DNA1ggatcctttaaccgaggagattattatagccggagctctgaagcagcaatctcagttctt61gtgatagtgagcaaagaactacaaactaacaccaaaatgcaagcttaaagcaaagtttat121tgaagcacaataatacactctgagggacagcgggcttatttctgcgaagtgaactcagca181cttctttacagagctcaaggtgcttttatggggtttgtggggaggagttgaggtttgggc241tgtatctgagtgacaggatgatgttatttgattgaagtttatagctatacaatctaaaat301taaactgtgcatggtcttacctataatttgttaagaaaagcctcccagggatgggggggc361aaaactgtatgtaaattctattataatgatggcatgatgaacttggggtgaacttgaaga421caggcttttgtgttgttgggcatgtgccacctta...
example 3
Characterization of Probands
[0045] The mean age of the twenty probands was 44±11 years (range 27-62 years); thirteen (65.0%) were men and seven (35.0%) were women. Eleven had iron overload. One had hepatic cirrhosis, two had diabetes mellitus, four had arthropathy, and two had hypogonadotrophic hypogonadism. One proband also had hereditary stomatocytosis, another had beta-thalassemia trait, a third had ethanol intake >60 g daily, and a fourth had porphyria cutanea tarda. No proband had evidence of excess oral or parenteral iron intake, or of viral hepatitis B or C. At diagnosis of hemochromatosis, evaluation for common HFE mutations revealed that eleven probands were C282Y heterozygotes, five were H63D heterozygotes, and four did not inherit C282Y or H63D.
[0046] The mean age of the initial 176 control subjects was 52±15 years (range 18-86 years); 79 (44.9%) were men and 97 (55.1%) were women. There was no significant difference in the mean ages of men and women. Frequencies of HFE...
PUM
Property | Measurement | Unit |
---|---|---|
concentration | aaaaa | aaaaa |
concentration | aaaaa | aaaaa |
hydrophobic | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap