Pichia pastoris formate dehydrogenase and uses therefor
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
embodiments
[0128] This invention encompasses, but is not limited to the following embodiments: [0129] An isolated nucleic acid comprising a nucleotide sequence encoding amino acid sequence SEQ ID NO:5. [0130] An isolated nucleic acid comprising a nucleotide sequence encoding at least 32 contiguous amino acids of SEQ ID NO:5. [0131] An isolated nucleic acid comprising a nucleotide sequence encoding at least 32 contiguous amino acids of the NAD-binding domain of SEQ ID NO:5. [0132] An isolated nucleic acid comprising a nucleotide sequence encoding at least 21 contiguous amino acids of the catalytic domain of SEQ ID NO:5. [0133] An isolated nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4. [0134] An isolated nucleic acid comprising at least 21 contiguous nucleotides of a nucleotide sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4. [0135] An isolated nuclei...
example 1
Identification of the P. pastoris FDH Gene
[0193] Library construction: Pichia pastoris strain GS115 (ATCC 20864) was grown in 10 ml of medium containing 1% Bacto yeast extract (DIFCO, Detroit, Mich.), 2% Bacto peptone (DIFCO), and 2% dextrose at 30° C. with vigorous shaking. After 24 hr, cells were harvested by centrifugation and chromosomal DNA prepared using the procedure described in Ausubel et al. (Eds.), 1981, Current Protocols in Molecular Biology, vol. 2, section 13.11.2, John Wiley and Sons, New York, N.Y. DNA was cleaved with restriction endonucleases BamHI, EcoRI, HindIII, KpnI, and PstI under conditions recommended by the manufacturer (Promega, Madison, Wis.). Approximately 3 μg of each digested DNA was electrophoresed at 20 v for 18 hr through a 0.8% agarose gel in TAE buffer (0.04 M Trizma base, 0.02 M acetic acid, and 0.001 M EDTA, pH 8.3) containing 0.5 μg / ml ethidium bromide. Fragments were transferred to a Hybond N+ nylon filter (Amersham Pharmacia, Piscataway, N.J...
example 2
Subcloning and Expression of P. pastoris FDH Gene in E. coli
[0206] Subcloning: The P. pastoris FDH gene was subcloned into expression vector pBMS2000 (disclosed in U.S. Pat. No. 6,068,991, issued May 30, 2000 to S. W. Liu et al.) as follows. Oligonucleotide primers containing the 5′ and 3′ end of the P. pastoris FDH gene along with compatible restriction endonuclease cleavage sites were prepared:
5′ TCGTCATGAAAATCGTTCTCGTTTTG 3′(5′ end; sense) BspHI(SEQ ID NO: 14)5′ TACTGTTTTTCCAGCGTATTCCTAGGCT 3′(3′ end; anti- BamHIsense)(SEQ ID NO: 15)
[0207] High-fidelity PCR amplification of the P. pastoris FDH gene was carried out in four 100 ml aliquots, each containing 1× TaqPlus reaction buffer (Stratagene), 0.2 mM each deoxynucleotide triphosphate (dATP, dCTP, dGTP, and dTTP), 0.4 nM each oligonucleotide, 2.5 U TaqPlus DNA polymerase (Stratagene), and 10 pg plasmid DNA containing the cloned P. pastoris FDH gene. The amplification conditions included incubation a...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Fraction | aaaaa | aaaaa |
| Molar density | aaaaa | aaaaa |
| Molar density | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More