Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant microorganisms and uses therefor

a technology of recombinant microorganisms and recombinant proteins, which is applied in the direction of transferases, carbon-carbon lyases, lyases, etc., can solve the problems that most bacteria are not known to produce terpenes, and not all bacteria comprise the necessary cellular machinery to produce terpenes and/or their precursors, etc., and achieves the effect of increasing the number of copies

Inactive Publication Date: 2013-12-05
LANZATECH NZ INC
View PDF4 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patent describes a method for producing terpenes and precursors thereof using microbial fermentation of substrates containing CO. The invention provides recombinant microorganisms that can produce these compounds and has the ability to overexpress or express exogenous enzymes involved in the production of terpenes. The recombinant microorganisms can also be adapted to produce other compounds using the same substrates. The invention offers an alternative to traditional methods of producing terpenes and provides a more efficient and cost-effective way to produce them.

Problems solved by technology

However, not all bacteria comprise the necessary cellular machinery to produce terpenes and / or their precursors as metabolic products.
In addition, most bacteria are not known to produce any terpenes which are of commercial value.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant microorganisms and uses therefor
  • Recombinant microorganisms and uses therefor
  • Recombinant microorganisms and uses therefor

Examples

Experimental program
Comparison scheme
Effect test

example 1

Expression of Isoprene Synthase in C. autoethanogenum for Production of Isoprene from CO

[0365]The inventors have identified terpene biosynthesis genes in carboxydotrophic acetogens such as C. autoethanogenum and C. ljungdahlii. A recombinant organism was engineered to produce isoprene. Isoprene is naturally emitted by some plant such as poplar to protect its leave from UV radiation. Isoprene synthase (EC 4.2.3.27) gene of Poplar was codon optimized and introduced into a carboxydotrophic acetogen C. autoethanogenum to produce isoprene from CO. The enzyme takes key intermediate DMAPP (Dimethylallyl diphosphate) of terpenoid biosynthesis to isoprene in an irreversible reaction (FIG. 1).

Strains and Growth Conditions:

[0366]All subcloning steps were performed in E. coli using standard strains and growth conditions as described earlier (Sambrook et al, Molecular Cloning: A laboratory Manual, Cold Spring Harbour Labrotary Press, Cold Spring Harbour, 1989; Ausubel et al, Current protocols in...

example 2

Expression of Isopentenyl-Diphosphate Delta-Isomerase to Convert Between Key Terpene Precursors DMAPP (Dimethylallyl Diphosphate) and IPP (Isopentenyl Diphosphate)

[0381]Availability and balance of precursors DMAPP (Dimethylallyl diphosphate) and IPP (Isopentenyl diphosphate) is crucial for production of terpenes. While the DXS pathway synthesizes both IPP and DMAPP equally, in the mevalonate pathway the only product is IPP. Production of isoprene requires only the precursor DMAPP to be present in conjunction with an isoprene synthase, while for production of higher terpenes and terpenoids, it is required to have equal amounts of IPP and DMAPP available to produce Geranyl-PP by a geranyltransferase.

Construction of Isopentenyl-Diphosphate Delta-Isomerase Expression Plasmid:

[0382]An Isopentenyl-diphosphate delta-isomerase gene idi from C. beijerinckii (Gene ID:5294264), encoding an Isopentenyl-diphosphate delta-isomerase (YP—001310174.1), was cloned downstream of ispS. The gene was amp...

example 3

Overexpression of DXS Pathway

[0385]To improve flow through the DXS pathway, genes of the pathway were overexpressed. The initial step of the pathway, converting pyruvate and D-glyceraldehyde-3-phosphate (G3P) into deoxyxylulose 5-phosphate (DXP / DXPS / DOXP), is catalyzed by an deoxyxylulose 5-phosphate synthase (DXS).

Construction of DXS Overexpression Expression Plasmid:

[0386]The dxs gene of C. autoethanogenum was amplified from genomic DNA with oligonucleotides Dxs-SalI-F (SEQ ID NO: 29: GCAGTCGACTTTATTAAAGGGATAGATAA) and Dxs-XhoI-R (SEQ ID NO: 30: TGCTCGAGTTAAAATATATGACTTACCTCTG) as described for other genes above. The amplified gene was then cloned into plasmid pMTL85246-ispS-idi with SalI and XhoI to produce plasmid pMTL85246-ispS-idi-dxs (SEQ ID NO: 31 and FIG. 4). DNA sequencing using oligonucleotides given in Table 3 confirmed successful cloning of ispS, idi, and dxs without mutations (FIG. 5). The ispS and idi genes are as described in example 1 and 2 respectively.

TABLE 3Oligo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
temperatureaaaaaaaaaa
pressureaaaaaaaaaa
pressureaaaaaaaaaa
Login to View More

Abstract

Terpenes are valuable commercial products used in a diverse number of industries. Terpenes may be produced from petrochemical sources and from terpene feed-stocks, such as turpentine. However, these production methods are expensive, unsustainable and often cause environmental problems including contributing to climate change. Microbial fermentation provides an alternative option for the production of terpenes. One or more terpenes and / or precursors can be produced by microbial fermentation of a substrate comprising CO. Recombinant microorganisms may be used in such methods. Carboxydotrophic, acetogenic, recombinant microorganisms can be used in such methods. The recombinant microorgnsims may contain exogenous mevalonate (MVA) pathway enzymes and / or DXS pathway enzymes, for example.

Description

FIELD OF THE INVENTION[0001]The present invention relates to recombinant microorganisms and methods for the production of terpenes and / or precursors thereof by microbial fermentation of a substrate comprising CO.BACKGROUND OF THE INVENTION[0002]Terpenes are a diverse class of naturally occurring chemicals composed of five-carbon isoprene units. Terpene derivatives include terpenoids (also known as isoprenoids) which may be formed by oxidation or rearrangement of the carbon backbone or a number of functional group additions or rearrangements.[0003]Examples of terpenes include: isoprene (C5 hemiterpene), farnesene (C15 Sesquiterpenes), artemisinin (C15 Sesquiterpenes), citral (C10 Monoterpenes), carotenoids (C40 Tetraterpenes), menthol (C10 Monoterpenes), Camphor (C10 Monoterpenes), and cannabinoids.[0004]Terpenes are valuable commercial products used in a diverse number of industries. The highest tonnage uses of terpenes are as resins, solvents, fragrances and vitamins. For example, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C12N15/74
CPCC12N15/74C12Y101/01267C12Y401/01033C12Y402/03027C12Y406/01012C12Y503/03002C12Y101/01088C12Y202/01007C12Y203/01009C12Y203/0301C12Y205/0101C12Y207/01036C12Y207/04002C12N15/52C12Y117/07001C12Y205/0109C12Y207/01148C12Y207/0706C12Y402/03046C12N9/88C12N9/1025C12N9/1205C12N9/1022C12N9/1229C12N9/1029C12N9/0006C12N9/1085C12P5/007Y02E50/30Y02A50/30C12P7/42C12P9/00
Inventor CHEN, WENDY YITINGLIEW, FUNGMINKOEPKE, MICHAEL
Owner LANZATECH NZ INC