Targeted small interference RNA formulation for preventing and treating Hepatitis C and its preparation method
A hepatitis C, small interference technology, used in gene therapy, antiviral agents, pharmaceutical formulations, etc., can solve the problem of low cation load, and achieve the effect of inhibiting virus replication and infection, increasing drug concentration, and improving therapeutic effect.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1: Preparation of targeting protein. Design primers Upstream primer 5'atgggaggtt ggtcttccaaacct'3 and downstream primer 5'aatgtatacccaaagacaaaagaaaatt'3, with HBV DNA as a template, the reaction system is: 5μl 10×RT Buffer, 10μl MgCl2, 10μl dNTPmixture, 1μl upstream primer, 1μl downstream primer, HBV DNA 2ng, TaqDNA polymerase 1μl, add water to 50μl. The PCR reaction conditions were: pre-denaturation at 94°C for 5 minutes, 30s at 94°C, 30s at 60°C, 2 minutes at 72°C, 30 cycles, and extension at 72°C for 10 minutes. The PCR product was purified with PCR purify Kit, connected with pMD18-T Vector, transformed, single clone was picked, positive clone was identified, and sequenced. Sequencing verified that the correct target protein DNA was cloned into the yeast expression vector pICZα, and after the correctness was verified by enzyme digestion, the expression vector was introduced into Pichia pastoris cells. First, the DNA of the yeast expression vector pICZα was ...
Embodiment 2
[0056] Example 2: Preparation of fusion protein composed of targeting molecule and nucleic acid binding molecule. Design the upstream primer 5'atgggaggtt ggtcttccaa acct'3 and the downstream primer 5'aatgtatacccaaagacaaaagaaaatt'3, using HBV DNA as a template, the reaction system is: 5μl 10×RT Buffer, 10μl MgCl 2 , 10μl dNTPmixture, 1μl upstream primer, 1μl downstream primer, HBV DNA 2ng, TaqDNA polymerase 1μl, add water to 50μl. The PCR reaction conditions were: pre-denaturation at 94°C for 5 minutes, 30s at 94°C, 30s at 60°C, 2 minutes at 72°C, 30 cycles, and extension at 72°C for 10 minutes. The PCR product was purified with PCR purify Kit, connected with pMD18-T Vector, transformed, single clone was picked, positive clone was identified, and sequenced. Code KKALLALALHHKKALLALALHHLALLAHHLALALKKAGG-NH 2 The 5'ggtggcgccaagaagttcgccctccaccacgccctcctcgccctccaccacctcgccctcgccctcctcgccaagaagcaccacctcgccctcgccctcctcgccaagaag3' sequence of the polypeptide is artificially synthesi...
Embodiment 3
[0057] Example 3: Preparation of branched nucleic acid-binding polypeptides.
[0058] Branched peptide synthesis can be carried out on the ABI431A solid-phase automatic peptide synthesizer or manually synthesized. The sequence structure is shown in Figure 1. Adopt standard Fmoc method, select 0.125mmol Fmoc-MAP-Branch-PSC resin, make peptide chain extend from C terminal to N terminal one by one according to sequence, the dosage of each amino acid is 0.5mmol, amino acid: resin=4: 1, the first Amino acid was connected to the resin with DMAP, the activation of amino acid was coupled with HOBt and DCC, and the Fmoc protecting group was removed with 20% piperidine solution. After the polypeptide is synthesized, according to the steps recommended by PE company, add the compound after ice bath to the 10ml cutting solution under the condition of ice bath, use cutting solution B, its components are 0.75mg of crystalline phenol, 0.25ml of EDT, 0.5ml of sulfide anisole. Ionized water 0....
PUM
| Property | Measurement | Unit |
|---|---|---|
| capacitance | aaaaa | aaaaa |
| electrical resistance | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
