Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Targeted small interference RNA formulation for preventing and treating Hepatitis C and its preparation method

A hepatitis C, small interference technology, used in gene therapy, antiviral agents, pharmaceutical formulations, etc., can solve the problem of low cation load, and achieve the effect of inhibiting virus replication and infection, increasing drug concentration, and improving therapeutic effect.

Inactive Publication Date: 2007-10-24
广州拓谱基因技术有限公司
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The disadvantage is that the cationic load is relatively small

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Targeted small interference RNA formulation for preventing and treating Hepatitis C and its preparation method
  • Targeted small interference RNA formulation for preventing and treating Hepatitis C and its preparation method
  • Targeted small interference RNA formulation for preventing and treating Hepatitis C and its preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1: Preparation of targeting protein. Design primers Upstream primer 5'atgggaggtt ggtcttccaaacct'3 and downstream primer 5'aatgtatacccaaagacaaaagaaaatt'3, with HBV DNA as a template, the reaction system is: 5μl 10×RT Buffer, 10μl MgCl2, 10μl dNTPmixture, 1μl upstream primer, 1μl downstream primer, HBV DNA 2ng, TaqDNA polymerase 1μl, add water to 50μl. The PCR reaction conditions were: pre-denaturation at 94°C for 5 minutes, 30s at 94°C, 30s at 60°C, 2 minutes at 72°C, 30 cycles, and extension at 72°C for 10 minutes. The PCR product was purified with PCR purify Kit, connected with pMD18-T Vector, transformed, single clone was picked, positive clone was identified, and sequenced. Sequencing verified that the correct target protein DNA was cloned into the yeast expression vector pICZα, and after the correctness was verified by enzyme digestion, the expression vector was introduced into Pichia pastoris cells. First, the DNA of the yeast expression vector pICZα was ...

Embodiment 2

[0056] Example 2: Preparation of fusion protein composed of targeting molecule and nucleic acid binding molecule. Design the upstream primer 5'atgggaggtt ggtcttccaa acct'3 and the downstream primer 5'aatgtatacccaaagacaaaagaaaatt'3, using HBV DNA as a template, the reaction system is: 5μl 10×RT Buffer, 10μl MgCl 2 , 10μl dNTPmixture, 1μl upstream primer, 1μl downstream primer, HBV DNA 2ng, TaqDNA polymerase 1μl, add water to 50μl. The PCR reaction conditions were: pre-denaturation at 94°C for 5 minutes, 30s at 94°C, 30s at 60°C, 2 minutes at 72°C, 30 cycles, and extension at 72°C for 10 minutes. The PCR product was purified with PCR purify Kit, connected with pMD18-T Vector, transformed, single clone was picked, positive clone was identified, and sequenced. Code KKALLALALHHKKALLALALHHLALLAHHLALALKKAGG-NH 2 The 5'ggtggcgccaagaagttcgccctccaccacgccctcctcgccctccaccacctcgccctcgccctcctcgccaagaagcaccacctcgccctcgccctcctcgccaagaag3' sequence of the polypeptide is artificially synthesi...

Embodiment 3

[0057] Example 3: Preparation of branched nucleic acid-binding polypeptides.

[0058] Branched peptide synthesis can be carried out on the ABI431A solid-phase automatic peptide synthesizer or manually synthesized. The sequence structure is shown in Figure 1. Adopt standard Fmoc method, select 0.125mmol Fmoc-MAP-Branch-PSC resin, make peptide chain extend from C terminal to N terminal one by one according to sequence, the dosage of each amino acid is 0.5mmol, amino acid: resin=4: 1, the first Amino acid was connected to the resin with DMAP, the activation of amino acid was coupled with HOBt and DCC, and the Fmoc protecting group was removed with 20% piperidine solution. After the polypeptide is synthesized, according to the steps recommended by PE company, add the compound after ice bath to the 10ml cutting solution under the condition of ice bath, use cutting solution B, its components are 0.75mg of crystalline phenol, 0.25ml of EDT, 0.5ml of sulfide anisole. Ionized water 0....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
capacitanceaaaaaaaaaa
electrical resistanceaaaaaaaaaa
Login to View More

Abstract

The invention discloses a targeted small interference RNA formulation for preventing and treating Hepatitis C and its preparation method, wherein the preparation comprises small interfering RNAs, hepatocyte targeted nucleinic acid leading-in carrier, the hepatocyte targeted nucleinic acid leading-in carrier comprises hepatocyte targeted molecules and / or nucleinic acid bonded molecules, by establishing nucleinic acid highly effective transfer hepatocyte architecture to the targeted hepatocyte carrier, siRNA capable of effectively inhibiting type C hepatitis viruse reproduction and infection can be screened at in vitro cell level, the siRNA is led into hepatocyte through in vivo system or local administration. The invention also provides an administration technology for targeting the liver tissues.

Description

technical field [0001] The invention relates to a targeted small interfering RNA preparation for preventing or treating hepatitis C, and also relates to a preparation method of the small interfering RNA preparation. Background technique [0002] About 75% of patients with acute HCV infection develop chronic hepatitis, and about 20% of them end up with cirrhosis, hepatocellular carcinoma or liver failure. There are about 170 million patients in the world, and the number of infected people in my country is about 50 million. Because HCV infection is a subclinical symptom, the actual number may be more. HCV infection has become one of the social public health problems that seriously threaten human health. So far there is no specific and effective method of prevention and treatment. [0003] HCV is a single-stranded positive-sense RNA virus belonging to the genus Hepacivirus in the family Flaviviridae. The HCV genome varies greatly and can be divided into four levels: genotype...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K48/00A61P1/16A61P31/12
Inventor 程度李宝健
Owner 广州拓谱基因技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com