Human TCRVbeta7.1_H3F7 gene and its screening method and application

A gene and gene sequence technology, applied in the field of gene sequence

Inactive Publication Date: 2008-01-09
GUANGDONG PHARMA UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

TCR gene screening for liver cancer-specific tumor antigens has not been reported so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human TCRVbeta7.1_H3F7 gene and its screening method and application
  • Human TCRVbeta7.1_H3F7 gene and its screening method and application
  • Human TCRVbeta7.1_H3F7 gene and its screening method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] Example 1: Anti-hepatocarcinoma-specific TCRβ gene was screened using the method of gene dominance

[0080] Peripheral blood mononuclear cells from liver cancer patients and healthy people were collected, respectively co-cultured with liver cancer cells and stimulated to separate T lymphocytes, and then the cells were washed twice with PBS, and the total RNA was extracted according to the method provided by the Invitrogen kit. The reverse transcription kit synthesizes cDNA from the extracted total RNA. The CDR3 primers of 26 family members of the TCRβ gene family were designed and synthesized respectively, and the cDNA reverse-transcribed from the total RNA extracted from the above two kinds of cells was used as a template for PCR amplification reaction. After the amplified products were separated by 1.2% agarose gel electrophoresis, a conservative sequence was selected to design and synthesize a digoxin-labeled probe for Southern hybridization and image development. It...

Embodiment 2

[0081] Embodiment 2: Utilize the PCR method to amplify the complete TCRVβ7.1 gene

[0082] According to the conserved sequence of the TCRVβ7.1 subfamily, design primers for amplifying the coding sequence of the TCRVβ7.1 gene family:

[0083] V7CK: ATT GAATTC+GCC+ATGGGCTGCAGGCTGCTCTGC

[0084] C2CK: GCC AAGCTT+CTAGCCCTCTGGAATCCTTTTCT

[0085] The front ends of the primers all contain three protective base sequences, the V7CK primers contain the sequence of the restriction endonuclease EcoR I, the C2CK primers contain the sequence of the restriction endonuclease HindIII, and the V7CK primers also contain the sequence of Kozark.

[0086] From normal human blood samples, through a series of procedures of lymphocyte separation-lymphocyte RNA extraction-reverse transcription of extracted RNA-PCR amplification, the TCRβ7.1 gene was finally cloned into the expression vector pcDNA-kan.

[0087] The EcoRI and HindIII sites in the multiple cloning site of the pcDNA-kan vector were sele...

Embodiment 3

[0088] Example 3: TCRVβ7.1_H3F7 gene-modified T cells induce apoptosis of liver cancer cells in vitro

[0089] After transfection of T cells with the specific TCRVβ7.1_H3F7 gene that recognizes liver cancer, flow cytometry and laser confocal light microscope detection confirmed the dominant expression of TCRVβ7.1_H3F7 molecules, as shown in Figure 4-Figure 8, left in Figure 6 The picture is the control group, and the right picture is the TCRVβ7.1_H3F7 gene transfection group. The left picture in Figure 7 is a laser confocal microscope diagram of TCRVβ7.1_H3F7 transgenic T cells interacting with liver cancer cells; the right picture is a schematic diagram of computer software analysis, the columnar part is the specific binding between T cells and liver cancer cells, and the other is non- idiosyncratic. The left picture in Figure 8 is the untransfected T cell group, and the right picture is the TCRVβ7.1 gene transfected T cell group. Co-cultured with liver cancer cells, DNA La...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A human TCRV beta 7.1-H3F7 gene, its gene sequence table, gene screening cloning method and use are disclosed. It can be used to prepare anti-cancer and anti-tumor vaccine and make research of other medicines.

Description

technical field [0001] The present invention relates to gene sequence, in particular to the sequence of human T cell antigen receptor TCRVβ7.1_H3F7 gene and its screening method and application. Background technique [0002] Due to the serious damage and unsatisfactory effects of radiotherapy and chemotherapy on the body, biological therapy has increasingly become the main goal of tumor treatment research, and immunotherapy is a major component of tumor biological treatment. The anti-tumor immune response generated by the body's immune system mainly includes cellular immunity and humoral immunity. The cellular immune response mediated by T cells is an important part of anti-tumor cellular immunity. T lymphocytes are the main cell population for antigen recognition by cellular immunity in the body. Specific antigens can only be recognized by the T cell antigen receptor TCR composed of specific amino acid sequences. The body specifically recognizes and kills tumor cells throug...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/12C07K14/435A61K48/00C12Q1/68A61P35/00
Inventor黄树林肖兰凤邵红伟陈伟吴凤麟沈晗
OwnerGUANGDONG PHARMA UNIV