Delivery system and application of chitosan mucosa compromising mucosal adjuvant

A technology of chitosan and mucosal adjuvant, applied in the fields of biochemical drugs and chemistry, can solve the problems that antigens cannot stay, cannot induce mucosal immune responses, etc., and achieve the effect of enhancing induction

Inactive Publication Date: 2008-06-25
FUDAN UNIV
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0015] The object of the present invention is to provide a chitosan mucosal delivery system containing a mucosal adjuvant. The chitosan mucosal delivery system containing a mucosal adjuvant will solve the problem that the antigen cannot Technical problems of effectively staying locally in the mucosa, insufficient presentation by APCs, and inability to induce an effective mucosal immune response

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Delivery system and application of chitosan mucosa compromising mucosal adjuvant
  • Delivery system and application of chitosan mucosa compromising mucosal adjuvant
  • Delivery system and application of chitosan mucosa compromising mucosal adjuvant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Example 1 Hela cell culture and CVB3 virus passage:

[0067] The human cervical cancer cell line Hela cell of the present invention is cultured according to conventional methods, with the RPMI-1640 medium containing 10% NBS, 2mM L-glutamine, 100U / ml penicillin and kanamycin sulfate at 37 ℃, 6% CO 2 cultured under the same conditions and passaged every other day. Infect approximately 5×10 6 For Hela cells, 80% of the cells were lysed by replicating virus after 40 hours of culture, and the liquid and cell fragments were centrifuged at 3000 rpm / min for 20 minutes, and the obtained supernatant was fresh CVB3 suspension.

Embodiment 2

[0068] LD of embodiment 2 CVB3 virus 50 (LD50) titration:

[0069] The 48-hr BALB / c suckling mice were taken out and divided into 8 groups, with 5 mice in each group, and the freshly prepared CVB3 suspension was sequentially diluted to 10 with NS in 10-fold serial dilution method. -1 、10 -2 、10 -3 、10 -4 、10 -5 、10 -6 、10 -7 、10 -8 , respectively take 40μl and inject 8 groups of suckling mice intraperitoneally, observe the survival of suckling mice every day, and calculate the LD of this batch of CVB3 virus according to the routine method of virology 50 potency.

[0070] Distance ratio = (>50% death percentage - 50) / (>50% death percentage - <50% death percentage)

[0071] LD 50 => 50% of the logarithm of the mortality dilution (Log) + distance ratio

[0072] LD of CVB3 in the same batch in this test 50 Valence is 10 -5.5 / 100μl

Embodiment 3

[0073] Example 3 Construction, in vitro expression and functional identification of target antigen gene and mucosal adjuvant gene plasmid DNA

[0074](1) (as shown in Figure 1) Construction of target antigen plasmid and mucosal adjuvant encoding plasmid: taking CVB3 structural protein VP1 as an example of target antigen and chemokine Ltn as an example of mucosal adjuvant, a pcDNA3. 1 is the pcDNA3.1-VP1 and pcDNA3.1-Ltn plasmids of the vector (or pVAX vector). Among them, the VP1 cDNA sequence is based on the literature (Klump WM, et al. J Virol, 1990, 64 (4): 1573-1583); the gene sequence of LTN is derived from NCBI GeneBank (NM-008510) as follows: agcccagcaa gacctcagcc atgagacttc tcctcctgac tttcctggga gtctgctgcctcaccccatg ggttgtggaa ggtgtgggga ctgaagtcct agaagagagt agctgtgtga acttacaaacccagcggctg ccagttcaaa aaatcaagac ctatatcatc tgggaggggg ccatgagagc tgtaatttttgtcaccaaac gaggactaaa aatttgtgct gatccagaag ccaaatgggt gaaagcagcg atcaagactgtggatggcag ggccagtacc agaaagaaca tggctga...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Gene lengthaaaaaaaaaa
Diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to a chitosan mucosal delivery system, and the invention comprises two components which are the target antigen nanoparticles and the mucosal adjuvant nanoparticles. The target antigen nanoparticle comprises chitosan and target antigen coding plasmid DNA; the mucosal adjuvant nanoparticle comprises chitosan and mucosal adjuvant coding plasmid DNA. The mucosal vaccine which is produced according to the mucosal delivery system comprises two components, a component is the chitosan-VP1 nanoparticle which is formed by the chitosan and the plasmid of the coding CVB3 structural protein VP1 and the other component is the chitosan-VP1 nanoparticle which is formed by the chitosan and the plasmid of the coding lymphocyte chemotactic factor. By using the mucosal delivery system to carry out the mucosal immunity, the secreting of CVB3 specific generalization IgG and intestinal tract SIgA is induced effectively, and the occurrence of the Coxsackie vital myocarditis is effectively prevented.

Description

technical field [0001] The invention relates to the field of chemistry, in particular to the field of biochemical drugs, in particular to a chitosan mucosal delivery system containing a mucosal adjuvant and its application. Background technique [0002] Pathogens that currently cause severe infectious diseases, such as human immunodeficiency virus (HIV), influenza virus, severe acute respiratory syndrome virus (SARS-CoV), etc., all invade and infect the body through mucosal surfaces (genital tract, respiratory tract, gastrointestinal tract) , because the body cannot induce an effective mucosal immune response to clear the pathogen of mucosal infection, the pathogen quickly spreads into the blood, and then invades the whole body, causing damage to the body; at the same time, it develops into a chronic infection, leading to serious disease. [0003] Coxsackie virus myocarditis is mainly caused by Coxsackie virus type B3 (CVB3) infection, and the incidence is higher in young ad...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K9/00A61K47/36A61K31/7088A61K39/12A61K39/395A61K39/39A61P31/12
Inventor徐薇熊思东岳艳
OwnerFUDAN UNIV