Unlock instant, AI-driven research and patent intelligence for your innovation.

In-situ purification immobilized enzymes and preparation thereof

An immobilized enzyme, in-situ technology, applied in the direction of immobilization on/in the organic carrier, can solve the problems of limited application, weak His-tag label and metal ion chelation, and achieve good effect and high activity recovery rate High and cost-saving effect

Inactive Publication Date: 2010-12-08
TSINGHUA UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

If immobilized metal chelation chromatography technology can be used in the production of immobilized enzymes, not only can the immobilization and purification of enzymes be completed in one step, but also the purification efficiency of enzymes is high, but the His-tag tag has weak chelating ability to metal ions. Limit its application on immobilized enzymes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • In-situ purification immobilized enzymes and preparation thereof
  • In-situ purification immobilized enzymes and preparation thereof
  • In-situ purification immobilized enzymes and preparation thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Target protein is the preparation of the immobilized enzyme of D amino acid oxidase (DAAO), comprises the steps:

[0054] (1) Take 15g of activated TVE resin (from United Laboratories), add 40ml of 0.1M Na 2 CO 3 and 3.6 g of iminodiacetic acid, adjusted to pH = 11 with 6M NaOH, mixed and stirred for 12 hours, and then thoroughly washed with 1 L of water for 3 times to obtain a chelating carrier.

[0055] (2) Construct plasmid pGEM-T-DAAO-Lab, the primers used are as follows:

[0056] Primer 1 5' ATGGCTAAAATCGTTGTTATTGGT 3'

[0057] Primer 2 5' TAACTGCAGCTAACAACAGCCACAGCCGTA

[0058] TCGGTTATGAAGGTTTGGACGAGT 3'

[0059] Primer 3 5' GATTTTAGCCATGATGTCGCTC 3'

[0060] Primer 4 5' CTAAAGGTTTGGACGAGTAAGAGCT 3'

[0061] Using the pET28-DAAO plasmid described by Luo Hui et al. (Acta Microbiology Sinica, 2004, 44 (3): 336-339) as a template, use the above primers 1 and 2 as primers to amplify the DAAO gene on the plasmid vector and design the primers The ...

Embodiment 2

[0087] Preparation of immobilized enzyme whose target protein is penicillin G acylase (PGA)

[0088] (1) Take 10g of activated resin carrier (Pharmaceutical Engineering of Beijing University of Chemical Technology), add 20ml 0.1M Na 2 CO 3 and 2.4 g of iminodiacetic acid, adjusted to pH = 11 with 6M NaOH, stirred and reacted for 16 h, and washed with 1 L of water for 3 times to obtain a chelating carrier.

[0089] (2) Construction of plasmid pGEMKT-PGA-Lab, the primers used are as follows:

[0090] Primer 1 5'TTAGTTCCTTAACGCGTCATCAGGCGGAG 3'

[0091] Primer 2 5'TAAACGCGTCTAACAACAGCCACAGCCG

[0092] TATCGGTTATGA AGGTTTGGACGAGT 3’

[0093] Using the genome of the ATCC11105 cell strain (purchased from the American ATCC Culture Collection Center) as a template, use the above primers 1 and 2 to PCR amplify the gene sequence behind the MluI restriction site at 2533bp of the PGA gene on the plasmid vector and introduce the gene sequence encoding His-Asn - the gene frag...

Embodiment 3

[0128] Preparation of immobilized enzyme whose target protein is GL-7-ACA acylase

[0129] (1) Take 15g of activated agar carrier (Jiupai Pharmaceutical), add 40ml 0.1M Na 2 CO 3 and 3.6 g of iminodiacetic acid, adjusted to pH = 11 with 6M NaOH, stirred and reacted for 12 hours, and then thoroughly washed to obtain a chelating carrier.

[0130] (2) To construct the plasmid pGEM-T-ACY-Lab, the primers used are as follows:

[0131] Primer 1 5' ATGGGCAGCAGCCAT 3'

[0132] Primer 2 5'CTAGCAGTTCGGTTTGTTCAGGTCGTGAATGTGATCCGGATATAG 3'

[0133] The ACY gene fragment was synthesized (Shanghai Sangong), and the synthetic ACY gene fragment was ligated with the pGEM-T plasmid by T-A ligation at 16°C for 3 h, and transformed into Top 10F'competent cells (purchased from Tiangen Company), and the transformation conditions ( See "Molecular Cloning Experiment Guide"); use LB plates with ammonium-resistant 37°C for 12 hours, select positive clones, and culture 24-well plates at 37°C for 12 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
specific surface areaaaaaaaaaaa
Login to View More

Abstract

The invention discloses an in situ purified immobilized enzyme which consists of a vector, a chelating agent, bivalent metallic ions and target proteins with label structure. The invention has the advantages of firm combination of the vector of the immobilized enzyme and the enzyme, stable use and high recovery activity of the immobilized enzyme. The invention also discloses a preparation method for the immobilized enzyme, which has the advantages that: immobilization and purification are completed in one step, thereby production process is simple; moreover, the vector can be recovered and reused time after time, thereby production cost is lowered and environmental pollution is reduced.

Description

technical field [0001] The invention belongs to the field of biocatalysis-immobilized enzymes, and in particular relates to an in-situ purified immobilized enzyme and a preparation method thereof. Background technique [0002] Immobilized enzymes, also known as solid-phase enzymes, refer to enzymes that are confined in a certain space after certain modifications, can simulate the action mode of enzymes in vivo, and can carry out effective catalytic reactions repeatedly and continuously. In theoretical research, immobilized enzymes can be used as a model to explore the role of enzymes in vivo; in actual use, the production process can be automated and continuous, and the use efficiency of enzymes can be improved. Enzyme immobilization technology is a technology that binds enzyme molecules by chemical or physical means for repeated use. Enzyme immobilization technology was produced and developed in the 1960s. Traditional enzyme immobilization methods can be roughly divided i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N11/06
Inventor 李强金泉杜静
Owner TSINGHUA UNIV