Bifidobacteria-bacillus coli shuttle expression vector, preparation method and application thereof
A technology of shuttle expression vector and bifidobacterium, which is applied in the field of genetic engineering, can solve the problems of single source of shuttle vector, influence on plasmid stability, and lack of stability, and achieve good biological safety, increased stability, and stable expression Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1 Construction of Bifidobacterium-Escherichia coli shuttle expression vector of the present invention
[0036] 1. replace the Ptac promoter (183-932) on the pGEX-5x-1 with the promoter AmyO (position: 599-690nt) of the α-amylase (amylase) gene (GenBank No: AY240946) of bifidobacteria, and simultaneously The LacIq fragment (position: 3301-4420nt) on pGEX-5x-1 was deleted by PCR method.
[0037] Specific steps are as follows:
[0038] 1. Use BamHI and SacII enzymes to cut 110 base pairs of the α-amylase gene AmyO (promoter) sequence synthesized by Shanghai Bioengineering Technology Co., Ltd., and add the M13 reverse sequencing primer sequence (taaaacgacggccagt) to its 5' end ( SEQ ID NO.6) for sequencing.
[0039] Its construction route is as follows:
[0040] (1) The promoter sequence of the bifidobacterium alpha-amylase gene: 599 ta aaataaacag catacgttcgcaatagtgca aacgctatca aagaagatga acccccgtta aagggattga agaaaaggaa taaaggagcc690 (SEQ ID NO.7);
[0041] (2...
Embodiment 2
[0065] Example 2 Using the Bifidobacterium-Escherichia coli shuttle expression vector of the present invention to construct engineering bacteria expressing the LTB gene
[0066] In this example, the heat-labile enterotoxin B subunit (abbreviated as LTB) gene (GenBank No: M17874; Position: 79-391nt) is connected to the Bifidobacterium-Escherichia coli shuttle expression vector pBEX prepared in Example 1 to construct the shuttle vector pBEX-LTB expressing the LTB gene (see attached Figure 11 ). Apparently, the Bifidobacterium-Escherichia coli shuttle expression vector pBEX prepared in Example 1 can also be used for the expression of all foreign genes and the production of genetic engineering products with Bifidobacteria as recipient bacteria.
[0067] 1. The steps of using the Bifidobacterium-Escherichia coli shuttle expression vector of the present invention to construct the engineering bacteria expressing the LTB gene are as follows:
[0068] (1) The ETEC LTB gene was ampli...
Embodiment 3
[0078] Example 3 Use Bifidobacterium-ETEC LTB recombinant bacteria of the present invention to prepare an oral live vaccine and verify the efficacy of the vaccine
[0079] 1. The Bifidobacterium-ETEC LTB recombinant bacterium prepared in Example 2 is made into lactic acid fermentation preparation, tablet and capsule preparation Bifidobacterium-ETEC LTB recombinant carrier oral live vaccine, used for prevention and treatment of diarrheal diseases caused by ETEC . It can also be used as a mucosal immune adjuvant for all oral vaccines.
[0080] 2. Validation of efficacy of oral live vaccines
[0081] 1) Test grouping (30 20-day-old male Kunming rats were randomly divided into the following 3 groups):
[0082] Vaccine immunization group, Bifidobacterium control group without recombinant vector and PBS control group.
[0083] 2) Kunming rat gavage immune test (4.0×10 9 Bacteria / only):
[0084] Bifidobacteria control group without recombinant vector: gavage with bifidobacteria ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 