Recombined cattle O type foot and mouth disease virus amalgamation protein vaccine
A foot-and-mouth disease virus and recombinant protein technology, which is applied in the field of genetic engineering recombinant protein vaccines, recombinant foot-and-mouth disease virus fusion protein vaccines for preventing animal foot-and-mouth disease virus infection and its preparation, can solve unsafe effects, incomplete inactivation of virulent viruses, etc. question
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0074] Embodiment 1 Construction of recombinant O-type foot-and-mouth disease virus fusion protein vaccine coding gene
[0075] 1.1 Construction of the gene encoding fragment A of the recombinant O-type foot-and-mouth disease virus fusion protein vaccine
[0076] The DNA fragment A of the recombinant O-type foot-and-mouth disease virus fusion protein vaccine coding gene was synthesized by two rounds of PCR. PCR primers (synthesized by Shanghai Sangon Bioengineering Co., Ltd.) with the following sequences were designed and synthesized:
[0077] Primer 1: 5′TCTTCAGGTTCTGGCTCAGAAAGCTGCTCGTACTCTGCCAGGTGGCGAAGAAAACTACGGTGGT 3′
[0078] Primer 2: 5′GAAGGATACGTCGGTGTGCTGACGACGCTGAACCTGAGCTTCACCACCGTAGTTTTCTT 3′
[0079] Primer 3: 5′GAATTCAGATCTGGTGGCCCGGTAACCAACGTTCGTGGTGATCTTCAGGTTCTGGCTC 3′
[0080] Primer 4: 5′ AAGCTTGGATCCCGGAGTTACTTTAACGAAACGGTCCAGGATGAAGGATACGTCGGTGT 3′
[0081] Use primer 1 and primer 2 as templates for the first round of PCR. The first round of PCR react...
Embodiment 2
[0101] Example 2 Recombinant O-type foot-and-mouth disease virus fusion protein vaccine coding gene subcloning into expression vector
[0102] The pMD18-T vector inserted with the gene encoding the AAN dimer was digested with EcoR I and HindIII to obtain the gene encoding the AAN dimer; the pET28a plasmid was digested with EcoR I and HindIII to obtain the pET28a linear vector. The fragments obtained in the above two steps and the vector were ligated with T4 DNase to obtain the pET28a vector [named pET28a-(AAN)2] containing the gene encoding the AAN dimer. Transform into host cells for amplification, and after extracting the plasmid, EcoRI, HindIII double enzyme digestion and identification, the length of the target fragment should be 1014bp ( Figure 6 ).
Embodiment 3
[0103] Example 3 Expression, identification and purification of recombinant O-type foot-and-mouth disease virus fusion protein vaccine
[0104] The pET28a-(AAN)2 recombinant expression plasmid was transferred into BL21 recipient bacteria. After clonal screening and identification, IPTG was used to induce the expression of protein J8 at a higher level. ( Figure 7 )
[0105] Plasmid pET28a has a histidine tail (His tag) at the rear end of the inserted target fragment and the front end of the stop codon, and the corresponding protein is identified by selecting an anti-His tag antibody. The results showed that the expressed protein could be recognized by the anti-His tag antibody, indicating that the protein induced and successfully expressed by us was the corresponding target protein ( Figure 8 ).
[0106] His tag can specifically bind to the metal ion nickel, so the method of metal ion Ni2+ chelation affinity chromatography was chosen to purify the target protein. The colu...
PUM
Login to view more Abstract
Description
Claims
Application Information
Login to view more - R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap