Recombined cattle O type foot and mouth disease virus amalgamation protein vaccine

A foot-and-mouth disease virus and recombinant protein technology, which is applied in the field of genetic engineering recombinant protein vaccines, recombinant foot-and-mouth disease virus fusion protein vaccines for preventing animal foot-and-mouth disease virus infection and its preparation, can solve unsafe effects, incomplete inactivation of virulent viruses, etc. question

Inactive Publication Date: 2008-10-29
BEIJING HYDVAX BIOTECH +1
View PDF0 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The immunogenicity of FMDV inactivated vaccine is better, but due to the use of strong virus in the preparation process and the possibility of incomplete virus inactivation, the potential unsafety affects its use

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombined cattle O type foot and mouth disease virus amalgamation protein vaccine
  • Recombined cattle O type foot and mouth disease virus amalgamation protein vaccine
  • Recombined cattle O type foot and mouth disease virus amalgamation protein vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0074] Embodiment 1 Construction of recombinant O-type foot-and-mouth disease virus fusion protein vaccine coding gene

[0075] 1.1 Construction of the gene encoding fragment A of the recombinant O-type foot-and-mouth disease virus fusion protein vaccine

[0076] The DNA fragment A of the recombinant O-type foot-and-mouth disease virus fusion protein vaccine coding gene was synthesized by two rounds of PCR. PCR primers (synthesized by Shanghai Sangon Bioengineering Co., Ltd.) with the following sequences were designed and synthesized:

[0077] Primer 1: 5′TCTTCAGGTTCTGGCTCAGAAAGCTGCTCGTACTCTGCCAGGTGGCGAAGAAAACTACGGTGGT 3′

[0078] Primer 2: 5′GAAGGATACGTCGGTGTGCTGACGACGCTGAACCTGAGCTTCACCACCGTAGTTTTCTT 3′

[0079] Primer 3: 5′GAATTCAGATCTGGTGGCCCGGTAACCAACGTTCGTGGTGATCTTCAGGTTCTGGCTC 3′

[0080] Primer 4: 5′ AAGCTTGGATCCCGGAGTTACTTTAACGAAACGGTCCAGGATGAAGGATACGTCGGTGT 3′

[0081] Use primer 1 and primer 2 as templates for the first round of PCR. The first round of PCR react...

Embodiment 2

[0101] Example 2 Recombinant O-type foot-and-mouth disease virus fusion protein vaccine coding gene subcloning into expression vector

[0102] The pMD18-T vector inserted with the gene encoding the AAN dimer was digested with EcoR I and HindIII to obtain the gene encoding the AAN dimer; the pET28a plasmid was digested with EcoR I and HindIII to obtain the pET28a linear vector. The fragments obtained in the above two steps and the vector were ligated with T4 DNase to obtain the pET28a vector [named pET28a-(AAN)2] containing the gene encoding the AAN dimer. Transform into host cells for amplification, and after extracting the plasmid, EcoRI, HindIII double enzyme digestion and identification, the length of the target fragment should be 1014bp ( Figure 6 ).

Embodiment 3

[0103] Example 3 Expression, identification and purification of recombinant O-type foot-and-mouth disease virus fusion protein vaccine

[0104] The pET28a-(AAN)2 recombinant expression plasmid was transferred into BL21 recipient bacteria. After clonal screening and identification, IPTG was used to induce the expression of protein J8 at a higher level. ( Figure 7 )

[0105] Plasmid pET28a has a histidine tail (His tag) at the rear end of the inserted target fragment and the front end of the stop codon, and the corresponding protein is identified by selecting an anti-His tag antibody. The results showed that the expressed protein could be recognized by the anti-His tag antibody, indicating that the protein induced and successfully expressed by us was the corresponding target protein ( Figure 8 ).

[0106] His tag can specifically bind to the metal ion nickel, so the method of metal ion Ni2+ chelation affinity chromatography was chosen to purify the target protein. The colu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a recombinant foot-and-mouth disease virus fusion protein vaccine designed on the basis of O type foot-and-mouth disease virus. Experiments prove that the vaccine of the invention which is produced by applying the genetic engineering technology has good effects for the prevention and treatment of foot-and-mouth disease virus infection. The invention provides an amino acid sequence of the recombinant foot-and-mouth disease virus fusion protein vaccine, a nucleotide sequence thereof and a research on the prevention of foot-and-mouth disease virus infection.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a genetic engineering recombinant protein vaccine, in particular to a recombinant foot-and-mouth disease virus fusion protein vaccine for preventing animal foot-and-mouth disease virus infection and a preparation method thereof. Background technique [0002] Foot-and-mouth disease (FMD) is an acute systemic highly contagious disease that mainly occurs in wild and domestic cattle, sheep, pigs and other artiodactyls. Foot-and-mouth disease virus (FMD) FMDV) is the pathogen that causes the disease. FMDV transmission mainly includes the digestive tract, respiratory tract, skin and mucous membranes. The infection rate of the animals is almost 100%. After the infection, the body temperature of the animals rises to 40-41°C, and the state is depressed. After 1 to 2 days, blisters appeared in the mouth, and at the same time or later, blisters also appeared on the soft skin between the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/135C12N15/42A61P31/14
Inventor王丽颖贾春澍王华金香兰杨明王华颖曹昭于永利
OwnerBEIJING HYDVAX BIOTECH