Process for high-efficiency expressing sTNFR/Fc fusion protein in yeast and uses thereof

A fusion protein and high-efficiency expression technology, which is applied to peptide/protein components, microbial-based methods, and medical preparations containing active ingredients. Low cost, easy to cultivate, fast propagation effect

Active Publication Date: 2008-11-26
INST OF BIOENG ACAD OF MILITARY MEDICAL SCI OF THE CHINESE
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, sTNFR / Fc fusion protein has a wide range of uses, however, sTNFR / Fc is a glycoprotein containing many pairs of intramolecular and intermolecular disulfide bonds, and the expression product of prokaryotic expression system has no activity
Although mammalian cells can express biologically active sTNFR / Fc fusion proteins, mammalian cells have problems such as slow growth, high culture costs, and difficulties in large-scale culture

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Process for high-efficiency expressing sTNFR/Fc fusion protein in yeast and uses thereof
  • Process for high-efficiency expressing sTNFR/Fc fusion protein in yeast and uses thereof
  • Process for high-efficiency expressing sTNFR/Fc fusion protein in yeast and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1: High expression of human sTNFRII / Fc in Pichia pastoris

[0046] 1. Construction of expression vector

[0047] Take acid citrate dextrose (ACD) anticoagulated venous blood from healthy people, dilute with Hanks solution, centrifuge lymphocytes with lymphocyte separation medium, and use 1640 medium (GIBCO) containing 10% fetal bovine serum (Hyclone company) Adjust the number of cells to 5 × 10 6 cells / mL, placed in a cell incubator for 2 hours and then replaced with fresh medium containing 1640 ester polysaccharide (LPS, 20 μg / mL) (Sigma) and 10% fetal bovine serum, and continued to culture for 5 hours to enrich cells by centrifugation; Total RNA was extracted by TRIzol (Shanghai Sangon Bioengineering Technology Service Co., Ltd.) method (operate according to TRIzol instructions); cDNA was obtained from total RNA after RT-PCR (operate according to RT-PCR kit instructions), and then used as Template, using primers N1 / C1, N2 / C2, pfu polymerase (TaKaRa) PCR to c...

Embodiment 2

[0051] Example 2: High expression of optimized human sTNFRII / Fc fusion gene in Pichia pastoris

[0052] 1. Gene optimization and synthesis

[0053] On the premise of not changing the amino acid sequence, the DNA sequence of sequence 3 was designed by replacing the codons in sequence 2 with yeast preferred codons, optimizing the secondary structure of mRNA, and reducing the hairpin structure. In order to synthesize the gene, we adopt the method of segmented synthesis and PCR splicing. That is, the DNA forward fragments of sequence 3 were first synthesized, each segment was 58bp, and its reverse complementary sequence was 58bp / segment, and each reverse segment was complementary to the previous segment and the subsequent segment of the forward sequence by 29 bp respectively. (Shanghai Sangon Bioengineering Technology Service Co., Ltd.). Get 1 pmol of all DNA fragments, mix, use primer 1: ATCTCGAGAAAAGAGCTTTGCCAGCTCAAGTTGCTTTCA (SEQID No.8) and primer 2: ACGAATTCTCTAGATCATTACTTA...

Embodiment 3

[0057] Example 3: High-efficiency expression of sTNFRII / Fc fusion protein in α-1,6-mannosyltransferase-deficient yeast

[0058] In this example, the Pichia pastoris GS115 (China Culture Collection Center, accession number CGMCC NO.1853) expression system after knockout of the α-1,6-mannosyltransferase (Ochlp) gene was used to express the TNF fusion protein. pPIC9 was used as the expression vector.

[0059] The pPIC9-sTNFRII-IgGFc2 plasmid constructed in Example 2 was linearized with Bgl II, and the prepared α-1,6-mannosyltransferase (Ochlp) gene knockout Pichia pastoris GS115 host bacteria was electrotransformed, and its Spread onto MD flat panels. Cultured at 30°C for 3 days to obtain yeast transformants. The transformants were inoculated into YPD medium, and cultured at 250 rpm for 24 hours at 30°C. Inoculate 25mL BMGY medium with 4% inoculum in 30°C and 250rpm for 24h, then start 0.05% methanol adaptation induction, 12h after 0.5% methanol induction, and then add 0.5% me...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for effectively expressing sTNFR / Fc fusion protein in yeast and the application thereof, which belongs to the medical field. The method for preparing tumor necrosis factor soluble receptor and antibody IgG Fc fragment fusion protein by the yeast comprises: (1) culturing the yeast including the gene used for encoding the fusion protein; (2) purifying and preparing the fusion protein from the culture. The invention has the advantage that the invention discloses a method for effectively expressing sTNFR / Fc fusion protein in the yeast and a purifying method thereof. The yeast is unicellular inferior eukaryote, which not only has the characteristics of being easy to culture prokaryote, low culturing cost, rapid propagation, convenient large-scale culture, high-density fermentation, and the like, but also has the sugar chain processing system of eukaryote; furthermore, the yeast can secrete foreign protein to culture fluid, which is beneficial to purification. Therefore, the method and the application thereof have favorable application prospect.

Description

technical field [0001] The present invention relates to a method for highly expressing sTNFR / Fc fusion protein in yeast and its application, more specifically, it provides a fusion protein of tumor necrosis factor soluble receptor and antibody IgG Fc fragment, its high-efficiency expression method and The use of the fusion protein as a medicine for diagnosing and treating tumor necrosis factor-related diseases belongs to the fields of bioengineering and medicine. Background technique [0002] Tumor necrosis factor-α (Tumor necrosis factor-α, TNF-α) is a pro-inflammatory factor that can stimulate the expression of neutrophils, fibroblasts, chondrocytes, etc. by binding to TNF-α receptors on the cell surface Other inflammatory factors (such as IL-1β, IL-6, IL-8, leukemia inhibitory factor) and proteases (including collagenase, neutral metalloproteinase). TNF-α can also induce the expression of endothelial adhesion molecules, which cause leukocytes and lymphocytes to pass thro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/62C12N1/19A61K38/16A61P35/00C12R1/84
Inventor巩新唱韶红刘波吴军
OwnerINST OF BIOENG ACAD OF MILITARY MEDICAL SCI OF THE CHINESE