Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Test paper strip for rapidly detecting brucellosis antibody

A Brucella, detection test paper technology, applied in the preparation of Brucella outer membrane protein bp26 genetically engineered antigen, Brucella antibody rapid detection test strip field, can solve indeterminate, especially medical history, contact History, occupation, eating habits, living areas and endemic areas, lack of simple, fast, specific and sensitive detection methods, insufficient knowledge of brucellosis, etc., to achieve the effect of saving manpower and material resources, easy promotion, storage and transportation

Active Publication Date: 2009-02-11
辽宁迪浩生物科技有限公司
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The main reasons for long-term misdiagnosis are as follows: (1) Insufficient understanding of brucellosis by clinicians is the main reason for misdiagnosis
(2) The epidemiological information is not detailed, especially the medical history, contact history, occupation, eating habits, living area and endemic area, etc.
(3) Diversified clinical manifestations and atypical clinical symptoms
(4) Lack of simple, rapid, specific and sensitive detection methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Test paper strip for rapidly detecting brucellosis antibody
  • Test paper strip for rapidly detecting brucellosis antibody
  • Test paper strip for rapidly detecting brucellosis antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1: the preparation of Brucella outer membrane protein bp26 genetic engineering antigen

[0034] (1) Obtaining the target gene

[0035] According to the sequence of the target gene fragment (GenBank accession number is AY166769) and the characteristics of the pGEX-4T-1 (Pharmacia) expression vector, primers containing restriction enzymes EcoR1 and Xho1 restriction sites at both ends were designed:

[0036] 5'gaattcatgaacactcgtgct3'

[0037] 5'gcctcgagttacttgatttcaa3'

[0038] Then, the target gene fragment bp26 was amplified from the Brucella genome. The amplification conditions were: denaturation at 95°C for 5 minutes; 1 minute at 95°C, 1 minute at 49.8°C, and 1 minute at 70°C for 35 cycles; finally, extension at 70°C for 10 minutes.

[0039] (2) Cloning of the target gene and screening of positive recombinants

[0040] After electrophoresis, the PCR amplified product was recovered by gel cutting, ligated with the PMD-18T cloning vector overnight at 16°C, ...

Embodiment 2

[0049] Example 2: Preparation of polyclonal antibody against outer membrane protein bp26

[0050] (1) Animal immunity:

[0051] Select 1-2kg New Zealand white rabbits, and inject bp26 protein subcutaneously in multiple points on the back, and the immunization dose is 1mg / kg. A total of 4 times of immunization.

[0052] (2) Immunological titer detection:

[0053] ELISA plate coated with bp26 protein, 4 μg per well. The titer of immune serum was detected by indirect ELISA method. When the serum titer reaches 1:20000 or more, serum can be collected.

[0054] (3) Antibody purification and verification:

[0055] Purification by conventional octanoic acid method. The purity was tested by non-denaturing PAGE electrophoresis, showing a protein band. The activity is tested by ELISA, and the titer is greater than 1:20000.

Embodiment 3

[0056] Embodiment 3: the development of Brucella antibody detection kit

[0057] (1) Preparation of colloidal gold-antigen conjugate:

[0058] It was determined by experiments that when bp26 protein was used as the gold-labeled antigen, the optimal binding pH value was 8.0, and the protein ratio was 46 μg / ml colloidal gold. After the labeled colloidal gold is treated with a stabilizer (0.5% BSA, pH8.0, 0.01M Tris buffer), take the colloidal gold-antigen conjugate solution in an amount of 65 μl per square centimeter, evenly adsorb it on the glass fiber, and freeze-dry it. , and stored in a dry environment.

[0059] (2) Coating antigen on nitrocellulose membrane:

[0060] The Brucella outer membrane protein bp26 was diluted to 3.5 ± 0.1 mg / ml with 0.01 M PBS. Dilute goat anti-mouse IgG polyclonal antibody to 2±0.1mg / ml with 0.01M PBS. Spray the two on the nitrocellulose membrane at a speed of 1 μl / cm with a film spraying machine to form a test line and a control line, respec...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a test strip for rapid detection of a Brucella specific antibody, which comprises a reaction film and a conjugate release pad. The reaction film has a detection band simultaneously coated with Brucella specific antigen bp26, and a quality control band of polyclonal antibody coated with Brucella outer-membrane protein bp26. The conjugate release pad is coated with colloidal golden labeled Brucella outer-membrane protein bp26. A membrane chromatography double antigen sandwich method is adopted to detect the Brucella specific antibody in a specimen. The test strip is simple in operation, convenient, and fast, and has the advantages of no requirements of special instruments and special training, clear and identified result, and easy popularization. The test strip is suitable for base course, large scale site detection of an accident and epidemiological investigation, and has auxiliary effect on the diagnosis of Brucella infection.

Description

technical field [0001] The invention belongs to the field of biological detection, and relates to the preparation of a Brucella outer membrane protein bp26 genetic engineering antigen, a test strip (colloidal gold method) for rapid detection of Brucella antibodies and an application thereof. technical background [0002] Brucellosis is a zoonotic infectious disease caused by Brucella, commonly known as wave fever. The clinical features are long-term fever, hyperhidrosis, arthralgia, fatigue, hepatosplenomegaly, etc. The disease is prevalent in different degrees in various countries in the world. [0003] People are mainly infected through the skin, mucous membranes, digestive tract and respiratory tract, especially Brucella melis and Brucella bovis. Brucella suis infection is rare in humans, Brucella canis infection is rare, and Brucella sheep epididymis and Brucella sarira basically do not infect humans. [0004] Brucellosis is easily misdiagnosed as rheumatic disease, ty...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/569G01N33/558G01N33/545
Inventor 刘明
Owner 辽宁迪浩生物科技有限公司
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More