Preparation of recombinant spore with surface for displaying lipase having catalytic activity
A surface display, catalytic activity technology, applied in biochemical equipment and methods, botanical equipment and methods, recombinant DNA technology, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Preparation of Recombinant Spores Displaying Bacillus subtilis Lipase (LipA) Using CotC as Carrier Protein
[0032] 1. Molecular Biology Operations
[0033] 1.1 Extraction of Bacillus subtilis chromosome
[0034] Centrifuge to collect 10mL Bacillus subtilis 168 (trp - ) (Bacillus Genetic Stock Center, Department of Biochemistry, The Ohio State University, West 12th Avenue, Columbus, Ohio, 43210, USA) culture, add 0.5ml TE to suspend the pellet. Add 30μl lysozyme (100mg / ml) to each microcentrifuge tube, react at 37°C for 1 hour; add 50μl SDS (10%) and 20μl proteinase K (20mg / ml), shake evenly, react at 37°C for 2 hours, add Extract the supernatant with an equal volume of phenol / chloroform, add 2 times the volume of ethanol, and centrifuge the DNA at 12,000 g for 10 minutes at room temperature for more than 2 hours. Discard the supernatant and wash the DNA precipitate with 500 μl of 75% ethanol to Remove inorganic salt ions. After the DNA precipitate is dried, add 30-...
Embodiment 2
[0070] Preparation of Recombinant Spores Displaying Bacillus subtilis LipA on the Surface Using CotB as Carrier Protein
[0071] 1. Molecular Biology Operations
[0072] Bacillus subtilis 168 (trp - ) Chromosome extraction, molecular biology technology, PCR amplification operation is the same as the molecular biology operation in the embodiment of the present invention 1
[0073] 2. Plasmid construction
[0074] 2.1 Basic plasmid construction The operation method is the same as 2.1 Basic plasmid construction in Example 1 of the present invention.
[0075] 2.2 Construction of integrated recombinant plasmid for fusion expression of CotB-LipA recombinant protein
[0076] According to the cotB (Gene BanK sequence number: NP_391486) sequence on the Bacillus subtilis 168 chromosome, the following primers were designed and synthesized:
[0077] cotB-1: GAGATCTAGAACGGATTAGGCCGTTTGTCC,
[0078] cotB-2:GAGAGGTACCGGATGATTGATCATCTGAAG.
[0079] To facilitate cloning, an XbaI site wa...
Embodiment 3
[0085] Preparation of recombinant spores displaying Bacillus subtilis lipase LipA using CotG as carrier protein
[0086] 1. Molecular Biology Operations
[0087] The extraction of Bacillus subtilis chromosome, molecular biology technology, PCR amplification operation is the same as the molecular biology operation in the embodiment of the present invention 1
[0088] 2. Plasmid construction
[0089] 2.1 Basic plasmid construction The operating method is the same as the construction of 2.1 plasmid in Example 1 of the present invention.
[0090] 2.2 Construction of integrated recombinant plasmid for fusion expression of CotB-LipA recombinant protein
[0091] According to the cotG (Gene BanK sequence number: NP_391486) sequence on the Bacillus subtilis 168 chromosome, the following primers were designed and synthesized:
[0092] cotG-1:GACAGGTCTAGACTCTGCCTTTGGAGACAGTGTCCC
[0093] cotG-2:GAGACAGGTACCGTCGTCGCAGTGGTGGTGCG
[0094] To facilitate cloning, an XbaI site was added t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
