Preparation of recombinant spore with surface for displaying lipase having catalytic activity

A surface display, catalytic activity technology, applied in biochemical equipment and methods, botanical equipment and methods, recombinant DNA technology, etc.

Inactive Publication Date: 2012-01-18
JIANGSU UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The present invention uses Bacillus subtilis spore capsid protein as a molecular carrier, displays lipase derived from bacteria or animal and plant cells with the function of hydrolyzing triacylglycerides on the surface of Bacillus subtilis spores, and constructs a surface-displayed recombinant lipase catalytic activity Bacillus, no similar reports or invention patents have been seen so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation of recombinant spore with surface for displaying lipase having catalytic activity
  • Preparation of recombinant spore with surface for displaying lipase having catalytic activity
  • Preparation of recombinant spore with surface for displaying lipase having catalytic activity

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Preparation of Recombinant Spores Displaying Bacillus subtilis Lipase (LipA) Using CotC as Carrier Protein

[0032] 1. Molecular Biology Operations

[0033] 1.1 Extraction of Bacillus subtilis chromosome

[0034] Centrifuge to collect 10mL Bacillus subtilis 168 (trp - ) (Bacillus Genetic Stock Center, Department of Biochemistry, The Ohio State University, West 12th Avenue, Columbus, Ohio, 43210, USA) culture, add 0.5ml TE to suspend the pellet. Add 30μl lysozyme (100mg / ml) to each microcentrifuge tube, react at 37°C for 1 hour; add 50μl SDS (10%) and 20μl proteinase K (20mg / ml), shake evenly, react at 37°C for 2 hours, add Extract the supernatant with an equal volume of phenol / chloroform, add 2 times the volume of ethanol, and centrifuge the DNA at 12,000 g for 10 minutes at room temperature for more than 2 hours. Discard the supernatant and wash the DNA precipitate with 500 μl of 75% ethanol to Remove inorganic salt ions. After the DNA precipitate is dried, add 30-...

Embodiment 2

[0070] Preparation of Recombinant Spores Displaying Bacillus subtilis LipA on the Surface Using CotB as Carrier Protein

[0071] 1. Molecular Biology Operations

[0072] Bacillus subtilis 168 (trp - ) Chromosome extraction, molecular biology technology, PCR amplification operation is the same as the molecular biology operation in the embodiment of the present invention 1

[0073] 2. Plasmid construction

[0074] 2.1 Basic plasmid construction The operation method is the same as 2.1 Basic plasmid construction in Example 1 of the present invention.

[0075] 2.2 Construction of integrated recombinant plasmid for fusion expression of CotB-LipA recombinant protein

[0076] According to the cotB (Gene BanK sequence number: NP_391486) sequence on the Bacillus subtilis 168 chromosome, the following primers were designed and synthesized:

[0077] cotB-1: GAGATCTAGAACGGATTAGGCCGTTTGTCC,

[0078] cotB-2:GAGAGGTACCGGATGATTGATCATCTGAAG.

[0079] To facilitate cloning, an XbaI site wa...

Embodiment 3

[0085] Preparation of recombinant spores displaying Bacillus subtilis lipase LipA using CotG as carrier protein

[0086] 1. Molecular Biology Operations

[0087] The extraction of Bacillus subtilis chromosome, molecular biology technology, PCR amplification operation is the same as the molecular biology operation in the embodiment of the present invention 1

[0088] 2. Plasmid construction

[0089] 2.1 Basic plasmid construction The operating method is the same as the construction of 2.1 plasmid in Example 1 of the present invention.

[0090] 2.2 Construction of integrated recombinant plasmid for fusion expression of CotB-LipA recombinant protein

[0091] According to the cotG (Gene BanK sequence number: NP_391486) sequence on the Bacillus subtilis 168 chromosome, the following primers were designed and synthesized:

[0092] cotG-1:GACAGGTCTAGACTCTGCCTTTGGAGACAGTGTCCC

[0093] cotG-2:GAGACAGGTACCGTCGTCGCAGTGGTGGTGCG

[0094] To facilitate cloning, an XbaI site was added t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a recombinant spore preparation method in which the bacillus subtilis spore surface displays the lipase with catalytic activity. The method includes: taking the bacillus subtilis spore capsid protein gene as molecular carrier to recombine with lipase gene having triglyceride hydrolysis and transesterification function, constructing amalgamation expressed integrated recombinant plasmid, and transforming the bacillus subtilis to obtain the recombinant strain, induce the spore surface produced by the recombinant strain to display the recombinant spore of the lipase. Compared with the known method in this field, the present inventive method displays lipases with triglyceride hydrolysis function from different sources on the surface of Bacillus subtilis spores,uses the unique resistance of the spores to increase the catalytic activity and stability of lipases.

Description

technical field [0001] The invention relates to the technical field of spore surface display, in particular to a method for preparing recombinant spores for displaying lipase with catalytic activity on the surface of Bacillus subtilis spores. Background technique [0002] Lipase (EC3.1.1.3) can catalyze the hydrolysis, synthesis or transesterification of esters to generate long-chain fatty acid monoesters, and has extremely wide application value in industrial production such as medicine, food, tanning, detergent, and energy . Especially the use of lipase to produce biodiesel is a more ideal energy-saving and environment-friendly process because of its low selectivity to raw materials, mild reaction conditions, low energy consumption, easy separation of products and by-products, and no pollution discharge. Watanabe Y, et al. J. Mol. Catal. B: Enzymatic, 2007, 44(324): 99-105). However, the main problems that limit the large-scale production of biodiesel by enzymatic method...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/62C12N15/55C12N15/31C12N15/75C12N1/21
Inventor宁德刚闻崇炜许小红
OwnerJIANGSU UNIV