Fusion protein and use of fusion protein in detection of histoplasma capsulatum
A technology of histoplasma bacteria and fusion protein is applied in the field of enzyme-linked immunosorbent assay to detect capsular histoplasma bacteria, which can solve the problem that large-scale promotion in primary medical institutions cannot be achieved, and achieves simple and easy preparation method, accurate use, and high efficiency. The effect of low production cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0033] The present invention will be described in further detail below with specific examples.
[0034] 1. Cloning of the M gene fragment of Histoplasma capsulatum
[0035] as attached figure 1 As shown, Histoplasma capsulatum was inoculated on the slant medium of glucose agar, cultured at 25°C for 3 weeks, and its genomic DNA was collected and extracted. Using the extracted Histoplasma capsulatum genomic DNA as a template, the M gene fragment of Histoplasma capsulatum was obtained by PCR method, and the primer sequences were as follows:
[0036] F1: 5'GCCATATGCCTCTAAACACGGCCGC 3' (upstream primer)
[0037] R1: 5'GCGGATCCTTTGTTGTTGGCGCTGTTAA 3' (downstream primer)
[0038] The PCR reaction conditions were denaturation at 94°C for 1 minute, annealing at 55°C for 15 seconds, extension at 72°C for 40 seconds, a total of 30 cycles, and finally extension at 72°C for 5 minutes. The PCR product was subjected to 1% agarose gel electrophoresis, recovered by cutting the gel and conn...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com