Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Bacillus thuringiensis HS18-1 and application thereof

A technology of Bacillus aureus, cgmccno.2718, applied in the field of Bacillus thuringiensis and its application in agricultural pest control

Active Publication Date: 2009-09-16
SICHUAN AGRI UNIV
View PDF0 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, studies have shown that resistance problems have not been found in the use of Bti in field (Regis L, et al., 2000. The use of bacterial larvicides in mosquito and black fly control programs in Brazil. Mem. Instituto Oswaldo Cruz, 95: 207-210 .), but the problem of mosquito resistance to it has been continuously confirmed in the laboratory, and this situation may also appear in the field (Georghiou GP, and Wirth MC, 1997. Influence of exposure to single versus multiple toxins of Bacillusthuringiensis subsp. israelensis on development of resistance in the mosquito Culex quinquefasciatus (Diptera: Culicidae). Applied and Environmental Microbiology, 63: 1095-1101.)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus thuringiensis HS18-1 and application thereof
  • Bacillus thuringiensis HS18-1 and application thereof
  • Bacillus thuringiensis HS18-1 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Screening and Identification of Bacillus thuringiensis

[0024] The soil was collected from the Wenjiang area of ​​Chengdu, Sichuan Province. Adopt sodium acetate-antibiotic separation method, take 10g soil sample and put into the shaking flask that 50ml sodium acetate medium is housed, add respectively 400 μ g / ml of penicillin sodium salt and gentamicin sulfate, shake table culture (200r / min , 30°C) 4h. After the cultivation, take 10ml of soil suspension, put it into a sterile centrifuge tube and centrifuge at 3000r / min for 15min, take 2ml of the upper cloudy solution and place it in a water bath at 65°C for 15min, take 0.1ml of the heat-treated cloudy solution and spread it on a plate, and place the plate in a 30°C incubator cultivated in. After 48 hours, smears of Bt-like strains were picked from the plate. A Bt strain with spherical crystal morphology was found (see attached figure 1). Observed by optical microscope and electron microscope, the cells ...

Embodiment 2

[0025] Example 2 Identification of cry gene in bacterial strain HS18-1

[0026] The total DNA of strain HS18-1 was extracted using a genomic DNA purification kit (purchased from Saibaisheng Company). Specific pairs were designed according to the conserved sequences of cry4 and cry30 genes, respectively.

[0027] Design a pair of specific primers based on the cry4 gene:

[0028] 5'-GTGTCAAGAGAACCAACAGTATG-3'

[0029] 5'-ACTAAGTCTCTCTCCTGTATGACCAG-3'

[0030] Design a pair of universal primers based on the cry30 gene:

[0031] 5'-AAGATTGGCTCAATATGTGTC-3'

[0032] 5'-GATTATCAGGATTCTACACTAG-3'

[0033] Use the following PCR reaction system for identification:

[0034] 10×buffer 2.5μl

[0035] MgCl 2 (25mM) 1.5μl

[0036] Taq enzyme 0.2μl

[0037] dNTPs (2.5mM) 2μl

[0038] Primer 2μl

[0039] Template 5 μl μ

[0040] Final reaction volume 25 μl

[0041] Thermal cycle reaction: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 1 minute, annealing at 54°...

Embodiment 3

[0042] Example 3 Cloning of cry4 and cry30 genes in bacterial strain HS18-1

[0043] Genomic DNA Purification Kit (purchased from Saibaisheng Company) was used to extract the total DNA of bacterial strain HS18-1; design its full-length gene primers P1, P2, P3, P4 (primer sequences are as follows); use the total DNA of bacterial strain HS18-1 as a template The primers were used for PCR amplification respectively, and the reaction system and reaction procedure were the same as in Example 2; using the total DNA of strain HS18-1 as a template, the full-length cry30 gene was amplified with P1 and P2 to obtain a fragment about 2 kb in length; and P4 to amplify the full-length cry4 gene to obtain a fragment about 3.5kb in length. The purified PCR products were connected to the pGEM-T vector, transformed, and a positive clone of the target fragment was picked and sequenced to obtain the sequences SEQ ID NO1 and SEQ ID NO 3 respectively.

[0044] P1: 5'ATGAATTTATATCAAAATGAAAATGA3'

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a Bacillus thuringiensis new bacterial strain HS18-1 with the preserving number CGMCC No.2718. Shown by the toxicity test of HS18-1, the HS18-1 has enormous toxicity towards Lepidoptera and Diptera insets. The Bacillus thuringiensis HS18-1 can be prepared into insecticides for the prevention and control of major crop insects, thus facilitating the diversification and systemization of Bacillus thuringiensis insecticide products, enlarging the usage scope of Bacillus thuringiensis insecticides, reducing the use of agricultural chemical, alleviating environment pollution, and having significant economic value and application prospect.

Description

technical field [0001] The invention relates to a new microbial strain and its application, in particular to a bacillus thuringiensis and its application in agricultural pest control. Background technique [0002] In the process of human production, insect pests are an important factor that causes agricultural production losses and affects human health. According to FAO statistics, the annual economic losses caused by insect pests in agricultural production worldwide are as high as 14%, disease losses reach 12%, and weed damage losses reach 11%. %. The loss was as high as 126 billion US dollars, equivalent to half of China's total agricultural output value, and more than four times that of the United Kingdom. In addition, mosquito-borne diseases occupy an important position in preventive medicine, among which mosquito-borne diseases such as dengue fever and yellow fever have strong transmissibility, wide prevalence, high incidence and great harm. According to WHO statistic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20A01N63/02A01P7/04C12R1/07
Inventor 郑爱萍李平朱军谭芙蓉王玲霞王世全邓其明李双成刘怀年
Owner SICHUAN AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com