Nest-type NEST-PCR amplification primer for detecting Clavibacter michiganensis subsp, michiganensis, detection kit and using method of kit thereof
A detection kit and tomato ulcer technology, applied in biochemical equipment and methods, microbial-based methods, DNA/RNA fragments, etc., can solve the problems of reducing the sensitivity of PCR methods, losing pathogenic bacteria, and not greatly improving the detection cycle. Achieve the effect of improving the quarantine level and simplifying the testing procedures
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0067] Embodiment 1: a kind of amplification primer of the nested Nest-PCR that detects tomato canker bacterium,
[0068] The nucleotide sequence of the first pair of primers whose upstream length is 28bp and whose downstream length is 26bp is as follows:
[0069] CMM-A: gtgatgtcagagcttgctctggcggatc;
[0070] CMM-a:gtacggctaccttgttacgacttagt;
[0071] The nucleotide sequence of the second pair of primers with an upstream length of 23 bp and a downstream length of 31 bp is as follows:
[0072] CMM-B: ccccgactctgggataactgcta;
[0073] CMM-b: cggttaggccactggcttcgggtgttaccga;
[0074] The amplification primer of the nested Nest-PCR of described detection tomato canker sore bacterium, its amplification condition is:
[0075] For the first set of primers, the amplification conditions are: increase the PCR cycle for 20 minutes, lyse the bacteria at a high temperature of 94 degrees Celsius; release DNA as an amplification template; the PCR reaction conditions are: denature at 94 d...
Embodiment 2
[0078] Embodiment 2: A nested Nest-PCR rapid detection kit of tomato canker bacterium, including PCR buffer 10 *, magnesium chloride 25mmol / L; dNTP 10mmol / L, Taq enzyme 2 IU / μL; Primer CMM-A and CMM-a each 10pmol / μL, primers CMM-B and CMM-b each 10pmol / μL, double distilled water 99%-100%, detection PCR tubes 6, positive control PCR tubes 3, negative control PCR tubes 3, 1 tube for positive control and 1 tube for negative control.
Embodiment 3
[0079] Embodiment 3: A nested Nest-PCR rapid detection kit of tomato canker bacterium, including PCR buffer 9 *, magnesium chloride 20mmol / L; dNTP 9mmol / L, Taq enzyme 2 IU / μL; Primer CMM-A and CMM-a each 15pmol / μL, primers CMM-B and CMM-b each 15pmol / μL, double distilled water 99%-100%, detection PCR tubes 6, positive control PCR tubes 3, negative control PCR tubes 3, 1 tube for positive control and 1 tube for negative control.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com