Unlock instant, AI-driven research and patent intelligence for your innovation.

Leptospira IgM antibody quick detection test strip

A technology for testing test paper and test strips, which is applied in the direction of measuring devices, instruments, scientific instruments, etc., can solve problems such as inability to achieve early diagnosis, and achieve the effects of saving manpower and material resources, simple operation, and easy promotion

Active Publication Date: 2009-12-02
辽宁迪浩生物科技有限公司
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0013] The above-mentioned tests all use known leptospira antigens to detect the corresponding antibodies in the blood, and cannot achieve early diagnosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Leptospira IgM antibody quick detection test strip
  • Leptospira IgM antibody quick detection test strip
  • Leptospira IgM antibody quick detection test strip

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Cloning expression of embodiment 1 Leptospira specific antigen ompL1 and LipL32 (1) amplification of ompL1 (accession number is EU022021) and LipL32 (accession number is AM936999) gene:

[0037] Design primers based on the sequence of the target gene fragment:

[0038] LipL32 primer sequence

[0039] 5'GCCGAATTCATGAAAAAACTTTCGATTTTG 3'

[0040] 5'GCCCTCGAGTTACTTAGTCGCGTCAGAAGC 3'

[0041] PCR parameters: 95°C for 5min; 95°C for 1min, 50°C for 30s, 70°C for 1min, 30 cycles; finally 70°C extension for 10min.

[0042] ompL1 primer sequence

[0043] 5'GCCGATATCATGAGAAAATTATCTTCTCTA 3'

[0044] 5'GCACTCGAGTTACTTTGCGTTGCTTTCGTC 3'

[0045] PCR parameters: 95°C for 5min; 95°C for 1min, 55°C for 30s, 72°C for 1min, 30 cycles; finally 72°C extension for 10min.

[0046] (2) Cloning of the target gene and screening of positive recombinants

[0047]After electrophoresis, the two PCR amplification products were recovered by cutting the gel, connected with the PMD-18T cloning ...

Embodiment 2

[0056] Example 2 Leptospira IgM antibody colloidal gold rapid detection test strip (see Figure 1)

[0057] (1) Preparation of colloidal gold-anti-human IgM conjugate:

[0058] It has been determined through experiments that the optimal binding pH of the anti-human IgM monoclonal antibody colloidal label is 8.0, and the ratio of colloidal gold and antibody is 40 μg / ml colloidal gold. After the labeled colloidal gold is treated with a stabilizer (0.5% BSA, pH8.0, 0.01M Tris buffer), take the colloidal gold-antibody conjugate solution in an amount of 65 μl per square centimeter, evenly adsorb on glass fiber, and freeze-dry , and stored in a dry environment.

[0059] (2) Coating antigen on nitrocellulose membrane:

[0060] The mixed expressed proteins (ompL1 and LipL32 mixed 1:1) were diluted to 3 mg / ml with 0.01M PBS. Anti-mouse IgG polyclonal antibody was diluted to 2mg / ml with 0.01M PBS. Spray the two on the nitrocellulose membrane at a speed of 1 μl / cm with a film spraying...

Embodiment 3

[0070] Embodiment 3 detection method (see figure 2 )

[0071] 100-150 μl of the patient's whole blood, plasma or serum sample is directly dropped into the "4" of the test strip of Example 2, the sample solution runs up the membrane, and the result is interpreted within 10-15 minutes.

[0072] result:

[0073] If the test sample contains Leptospira IgM antibody, it will form a corresponding complex with the colloidal gold-labeled anti-human IgM monoclonal antibody on the test strip, and go up with the Leptospira specific antigen coated on the nitrocellulose membrane. Combined, a red line is formed, i.e. a red band at T.

[0074] Regardless of whether the specimen contains the corresponding antibody or not, the colloidal gold-labeled anti-human IgM monoclonal antibody continues to crawl upward and forms a red precipitation line with the anti-mouse IgG coated on the membrane, that is, a red band is formed at "C". This line is a quality control line. If the colloidal gold fails...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a quick detection test strip for detecting leptospira IgM antibody, comprising a reaction film and a combination releasing pad; wherein the reaction film is provided with a detection zone capable of wrapping leptospira specific antigen ompL1 and LipL32 and a quality control zone encasing secondary antibody IgG, and the combination releasing pad is encased by anti-human IgM monoclonal antibody marked by colloidal gold. Leptospira specific IgM antibody in a specimen is detected by applying membrane chromatography capturing method. The test strip of the invention is applied to detection and is easy, convenient, fast and short-cut to operate, special instrument or equipment or professional training are not needed, the result is clear and easy to recognize, and the operation is easy, thus being easy to popularize, being applicable to basic level, field detection and early diagnosis, and being beneficial to leptospira infection diagnosis.

Description

technical field [0001] The invention belongs to the field of biological detection, and in particular relates to a Leptospira IgM antibody detection test strip and an application thereof. Background technique [0002] Leptospirosis is an acute infectious disease caused by pathogenic Leptospira (abbreviated as Leptospira). Rodents, pigs and other livestock are the main sources of infection. Leptospira is excreted with the urine of bacteria-carrying animals and pollutes water sources. When people come into contact with infected water, they are infected through the skin and mucous membranes. The onset is mostly in the summer and autumn rice harvesting season or after heavy rain and flood. After a person is infected with leptospirosis, the incubation period is usually 1 to 3 weeks. First, sepsis is formed, which may have various clinical manifestations, including common type, pulmonary hemorrhage type, icteric hemorrhage type, and meningoencephalitis type. About 1 week after ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/577G01N33/569G01N33/558G01N33/545
Inventor 刘明
Owner 辽宁迪浩生物科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More