Method for expressing androctonus australis hector toxin by saccharomyces cerevisiae
A yeast expression and North African scorpion technology, applied in the biological field, can solve problems such as blocked exports, increased residual toxicity, and straight-up increase in pest resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] AaHIT1 was amplified by PCR using the plasmid pMD18-T / AaHIT1 with the AaHIT1 gene as a template and P1 (SEQ No. 1: 5'GCGAAGCTTATGAAGAAGAACGGCTACGCGGTGGACAGC 3') and P2 (SEQ No. 2: 5'GGCGGATCCTTAGTTGATGATGGTGGTGTCGCAGT 3') as primers Gene, PCR reaction cycle: 94°C for 2 minutes, 35 cycles at 94°C for 30 seconds-62°C for 30 seconds-72°C for 30 seconds, and 72°C for 5 minutes.
[0055] The PCR products were detected by electrophoresis and recovered for use.
[0056] Electrophoresis recovery of PCR products, the main steps are:
[0057] 1) PCR products were separated by electrophoresis using Agarose gel. Separate the target DNA fragment from other DNA as much as possible, then use a clean scalpel to cut off the agar block containing the DNA to be recovered, and put it into a 1.5mL centrifuge tube.
[0058] 2) Add 400 μL of Solution SN per 100 mg of Agarose gel, place in a water bath at 55-65°C for 5 minutes, and mix several times in the middle until the gel is completely ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com