[0053] Example 1
[0054] Using the plasmid pMD18-T/AaHIT1 with the AaHIT1 gene as a template, P1 (SEQ No.1: 5'GCGAAGCTTATGAAGAAGAACGGCTACGCGGTGGACAGC 3'), P2 (SEQ No. 2: 5'GGCGGATCCTTAGTTGATGATGGTGGTGTCGCAGT 3') as primers for PCR amplification of AaHIT1, Gene, PCR reaction cycles are: 94°C for 2 minutes, 94°C for 30 seconds-62°C for 30 seconds-72°C for 30 seconds, 35 cycles, 72°C for 5 minutes.
[0055] The PCR product is recovered for use after electrophoresis detection.
[0056] The main steps to recover PCR products by electrophoresis are:
[0057] 1) The PCR products are separated by electrophoresis using Agarose gel. Separate the target DNA fragment from other DNA as much as possible, and then use a clean scalpel to cut off the agar block containing the DNA to be recovered and put it into a 1.5 mL centrifuge tube.
[0058] 2) Add 400μL of Solution SN per 100mg of Agarose glue, place in a 55-65℃ water bath for 5 minutes, and mix several times in the middle until the glue is completely melted. After the gel melts, add 100μL of Solution B to every 400μL of Solution SN, and mix well.
[0059] 3) Put the 3S column into a 2mL collection tube, transfer the melted glue solution to the 3S column, open the lid, and leave it at room temperature for 2 minutes. Cover the centrifuge tube lid and centrifuge at 10,000rpm×1min at room temperature.
[0060] 4) Remove the 3S column, discard the waste liquid in the collection tube, put the 3S column into the same collection tube, add 600μL of washing buffer, and centrifuge at 10,000rpm×1min at room temperature.
[0061] 5) Repeat step 4) once.
[0062] 6) Remove the 3S column, discard the waste liquid in the collection tube, put the 3S column into the same collection tube, and centrifuge at 10,000 rpm×2 minutes at room temperature.
[0063] 7) Put the 3S column into a new 1.5mL centrifuge tube, add 30μL TE buffer to the center of the 3S column membrane, do not cover the centrifuge tube lid, and leave it at room temperature for 2 minutes.
[0064] 8) Cover the centrifuge tube lid and centrifuge at 10,000 rpm×1 minute at room temperature. The liquid in the centrifuge tube is the recovered DNA fragment, which is stored at -20°C for later use.
[0065] pYES 2 The plasmid and pMD18-T/AaHIT1 plasmid were digested with BamH I and HindIII, respectively, and recovered by electrophoresis detection. After the digested product is detected by electrophoresis, the small fragment of pMD18-T/AaHIT1 plasmid (ie AaHIT1 fragment) and pYES are recovered 2 Large plasmid fragment, the recovered AaHIT1 fragment and pYES 2 The vector is ligated by T4 ligase to obtain pYES 2 /AaHIT1 recombinant expression vector plasmid.
[0066] pYES 2 /AaHIT1 plasmid sequencing results show that the above connection is correct.
[0067] The recombinant plasmid was transformed into E. coli DH5α competent cells to prepare a large number of recombinant plasmids. The preparation of DH5α competent cells and plasmid transformation methods are as follows:
[0068] 1) Pick DH5α single clone and place it in 5mL LB liquid medium, and culture it overnight at 37°C on a 200rpm shaker.
[0069] 2) Insert 1% of the inoculum into fresh 5mL LB liquid medium, and shake at 37°C to O.D.600≈0.5.
[0070] 3) Dispense the bacterial liquid into sterile pre-cooled 1.5 mL Ep tubes, ice bath for 10 minutes, 5000 rpm × 5 minutes, and centrifuge at 4°C.
[0071] 4) Discard the supernatant and add 1mL of pre-cooled 100mM CaCl 2 , Ice bath for 30 minutes, 5000 rpm × 5 minutes, 4°C centrifugation.
[0072] 5) Discard the supernatant and add 100μL of pre-chilled 100mM CaCl 2 , Resuspend and store at 4℃ for later use.
[0073] Extract a large amount of pYES according to conventional methods 2 /AaHIT1 recombinant plasmid.
[0074] PYES 2 /AaHIT1 recombinant plasmid transforms yeast INVSC1 to obtain genetically engineered AINVSC1. Methods as below:
[0075] 1. Competent preparation of yeast INVSC1
[0076] 1) INVSC1 yeast 50mL YPD medium, 30°C, 200rpm shaker to OD600≈(1.0-1.5). Centrifuge at 4°C at 3000 rpm for 5 minutes, discard the supernatant to collect the bacteria.
[0077] 2) Resuspend the centrifuged cells with 20mL 1x TE/LiAC (0.1M/0.1M Ph7.5) solution, and shake at 30°C for 45 minutes.
[0078] 3) Add 0.5mL DTT solution and shake at 30°C for 15 minutes.
[0079] 4) Centrifuge at 3500 rpm in a centrifuge at 4°C for 5 minutes, and discard the supernatant.
[0080] 5) Add 20mL ddH2O, centrifuge at 3000rpm at 4°C for 5 minutes, and discard the supernatant.
[0081] 6) Add 1 mL of pre-chilled sorbitol to resuspend the cells.
[0082] 2. Electrotransformation of yeast INVSC1 by pYES2/AaHIT1
[0083] 1) Add 3 μL of the above ligation product to 40 μL of INVSC1 competent cells.
[0084] 2) Turn on the electrotransmitter, and the electrotransmission conditions are 1.5kv, 20μF, and 200Ω.
[0085] 3) Add 300 μL of sorbitol to the electrotransformed cells and mix them, resuscitate at 28-30°C for 1-2 hours, and then spread them on the SC-U(Cm+) medium plate.
[0086] 3. Cell culture and identification after pYES2/AaHIT1 plasmid transfer
[0087] 1) The clones grown after transformation are added to 3mL SC-U(Cm+) liquid medium and cultured overnight at 28°C in a shaker.
[0088] 2) Take 1.5 mL of the bacterial culture solution in the late logarithmic growth phase and centrifuge at 13000 rpm in a 4°C centrifuge for 1 minute to discard the supernatant.
[0089] 3) Add 100μLTE buffer to suspend the cells.
[0090] 4) Add 200 μL of lysis solution, 200 μL of phenol:chloroform:isoamyl alcohol, shake gently, and centrifuge at 13000rpm in a 4°C centrifuge for 5 minutes.
[0091] 5) Take the supernatant, add an equal volume of absolute ethanol to precipitate the DNA, and store it at -20°C for 0.5 hours.
[0092] 6) Centrifuge at 12000rpm for 10 minutes in a centrifuge at 4°C, discard the supernatant, and add 600μ70% ethanol to wash.
[0093] 7) Centrifuge at 12000 rpm in a centrifuge at 4°C for 10 minutes, discard the supernatant, dry at 37°C, and detect by 1% agarose gel electrophoresis.
[0094] Toxin protein expression test method in engineered strain:
[0095] Pick the colony of engineering bacteria AINVSC1, place it in 2mL SC-U(Cm+), culture overnight at 28℃, 200rpm shaker, take out 100μL of bacterial solution from it and add it to SC-U(Cm+), culture at 28℃, 200rpm shaker, Centrifuge the removed bacterial solution at 4°C at 5000 rpm for 10 minutes, discard the supernatant and add 100 μL of protein loading buffer, mix well, and treat it in a boiling water bath for 10 minutes to fully lyse the cells. Use the INVSC1 bacterial extract as a control and pass SDS- Polyacrylamide electrophoresis detection, stain with Coomassie brilliant blue after electrophoresis.
[0096] The leaf spraying method was used to spray corn leaves to feed Mythimna seperata Walker to detect the insecticidal activity of the scorpion insect toxin AaHIT1 expressed by the yeast engineering strain AINVSC1. The method of spraying engineered bacteria liquid and bacterial liquid supernatant to feed the armyworm.
[0097] In the first group, sample 1, the engineering strain AINVSC1, was used to spray corn leaves to feed armyworms. The treatment of sample 1 was to incubate the AINVSC1 bacteria on a shaker at 28°C for 24 hours. A total of 20 armyworms were placed in 20 plastic tubes. The armyworms were hungry and fed for 12 hours before treatment, and then sprayed every 12 hours for 72 hours. The treatment temperature was about 25℃ and the death of armyworms was observed. The experiment was repeated three times.
[0098] In the second group, sample 2, the supernatant of the engineering strain AINVSC1, was sprayed with corn leaves to feed the armyworm. The treatment of sample 2 is to incubate the AINVSC1 strain on a shaker at 28°C for 24 hours, centrifuge the bacterial solution at 4°C, 12000rpm×20 minutes, and spray the supernatant on corn leaves to feed the armyworm. Mythimna feeding is the same as above.
[0099] In the above two experiments, the control is INVSC1 bacterial liquid (CK1) and water control (CK2), that is, INVSC1 bacterial liquid is cultured in a shaker at 28°C for 24 hours and then the bacterial liquid is sprayed on corn leaves to feed armyworms and corn leaves are sprayed with water to feed armyworms. .
[0100] The insecticidal experiment results of the spraying leaf feeding method showed that the AINVSC1 yeast liquid and the supernatant of the bacterial liquid after the high-speed centrifugation of the bacteria have contact killing activity against the armyworm, and the contact killing activity of the bacterial liquid supernatant is significantly higher than that of the bacterial liquid. Activity (see Table 1 for the results). From the data in the table, it can be concluded that the contact effect of the AINVSC1 bacterial liquid on the armyworm is weak, and the corrected mortality rate is 43.8%. However, the contact activity of the sample 2 that is the supernatant of the AINVSC1 bacterial liquid on the armyworm is significantly higher than that of the sample 1. Activity, its corrected mortality rate reached 64.8%, which is much higher than that of sample 1.
