Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for expressing androctonus australis hector toxin by saccharomyces cerevisiae

A yeast expression and North African scorpion technology, applied in the biological field, can solve problems such as blocked exports, increased residual toxicity, and straight-up increase in pest resistance

Inactive Publication Date: 2010-02-17
SHANGHAI NORMAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the large-scale production and use of chemical pesticides has brought about three major problems: (1) environmental pollution, increased residual toxicity, and both humans and animals have been poisoned; ecological balance
(4) The use of traditional chemical pesticides with high residues has caused the residues of agricultural and livestock products to seriously exceed the standard, resulting in blocked exports
[0006] The work of expressing North African scorpion toxin through prokaryotic system is in progress. The existing problem is that the activity of the expression product is low. The main reason is that AaHIT1 is a eukaryotic gene, and eukaryotic gene expression in prokaryotic system is prone to inclusion bodies, resulting in relatively low activity. low expression product
Saccharomyces cerevisiae is a probiotic closely related to people's daily life, and will not pose a threat to the environment; although researchers in this field can speculate that the North African scorpion toxin gene, as a eukaryotic gene, should be in the eukaryotic It has high activity when expressed in the expression system, but so far it has not been able to find a method to efficiently express North African scorpion toxin and use it to kill armyworms by using Saccharomyces cerevisiae

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for expressing androctonus australis hector toxin by saccharomyces cerevisiae
  • Method for expressing androctonus australis hector toxin by saccharomyces cerevisiae
  • Method for expressing androctonus australis hector toxin by saccharomyces cerevisiae

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] AaHIT1 was amplified by PCR using the plasmid pMD18-T / AaHIT1 with the AaHIT1 gene as a template and P1 (SEQ No. 1: 5'GCGAAGCTTATGAAGAAGAACGGCTACGCGGTGGACAGC 3') and P2 (SEQ No. 2: 5'GGCGGATCCTTAGTTGATGATGGTGGTGTCGCAGT 3') as primers Gene, PCR reaction cycle: 94°C for 2 minutes, 35 cycles at 94°C for 30 seconds-62°C for 30 seconds-72°C for 30 seconds, and 72°C for 5 minutes.

[0055] The PCR products were detected by electrophoresis and recovered for use.

[0056] Electrophoresis recovery of PCR products, the main steps are:

[0057] 1) PCR products were separated by electrophoresis using Agarose gel. Separate the target DNA fragment from other DNA as much as possible, then use a clean scalpel to cut off the agar block containing the DNA to be recovered, and put it into a 1.5mL centrifuge tube.

[0058] 2) Add 400 μL of Solution SN per 100 mg of Agarose gel, place in a water bath at 55-65°C for 5 minutes, and mix several times in the middle until the gel is completely ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for expressing androctonus australis hector toxin by saccharomyces cerevisiae, successively comprising the following steps: providing a androctonus australis hector toxin gene AaHIT1; building a recombinant plasmid pYES2 / AaHIT1 expressing AaHIT1 protein in yeast cells; converting recombinant plasmid pYES2 / AaHIT1 into saccharomycetes cells; screening to obtain a converted bacterial strain AINVSC1 and identifying; cultivating the converted bacterial strain AINVSC1, and expressing androctonus australis hector toxin protein. The obtained androctonus australis hector toxin protein expressed by eukaryon has favourable insecticidal activity on armyworms and is suitable for producing in the biopesticide field.

Description

technical field [0001] The invention belongs to the field of biological technology, in particular to a method for expressing North African scorpion toxin by Saccharomyces cerevisiae. Background technique [0002] Mythimna seperata Walker is an insect of the order Lepidoptera, also known as shaving insects and army insects. It is an important pest of food crops in my country. It migrates back and forth from north to south every year. When a large outbreak occurs, it can eat up the leaves of the crops, resulting in a large area of ​​production reduction. Or no harvest, and it has no diapause, high reproduction rate, and large body shape, which is representative to a certain extent. In China, many pesticide research institutions regard it as the target of new pesticide screening. [0003] At present, the control measures of armyworm mainly use chemical pesticides. However, the large-scale production and use of chemical pesticides has brought about three major problems: (1) env...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C12P21/02C12R1/865
Inventor 黄晶心付盈盈肖明
Owner SHANGHAI NORMAL UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More