Alpha-galactosidase and coding gene thereof

A technology for galactosidase and encoding gene, which is applied in the field of alpha-galactosidase and its encoding gene, can solve the problems of low similarity of alpha-galactosidase, high price, time-consuming and labor-intensive, etc., and achieves good commercial application effect of value

Active Publication Date: 2013-04-03
BEIJING CHALLENGE AGRI SCI & TECH CO LTD
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0017] In addition, the means of isolating α-galactosidase in the existing technology are limited, mainly by constructing a genomic library or purifying protein
Both methods are time-consuming, inefficient and expensive
The similarity of α-galactosidase in different species is low, and it is difficult to obtain the gene sequence for such a strain that has never reported α-galactosidase
This is also a challenge to existing methods to obtain unknown new genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Alpha-galactosidase and coding gene thereof
  • Alpha-galactosidase and coding gene thereof
  • Alpha-galactosidase and coding gene thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Embodiment 1, the acquisition of α-galactosidase coding gene

[0057] 1. Obtain the partial sequence of the enzyme-encoding gene by designing degenerate primers

[0058] Aspergillus pylorus belongs to the genus Aspergillus, so search for the existing α-galactosidase gene protein sequence derived from Aspergillus, using the multiple sequence alignment program

[0059] BLOCKS[http: / / blocks.fhcrc.org / block / make_blocks.html] analysis found two conservative sequences W(G / E)IDYLKYD and HPAEYWSGP. Based on these two conserved sequences, a pair of degenerate primers were designed to amplify the partial α-galactosidase sequence from the genomic DNA of Aspergillus pyrogenus by PCR.

[0060] Degenerate primers were designed based on the two conserved regions and synthesized using a DNA synthesizer. PCR amplification was carried out using the genomic DNA of Aspergillusustus as a template. Except for degenerate primers and genomic DNA templates, other reagents used for PCR amplif...

Embodiment 2

[0181] Embodiment 2, genetic engineering expression obtains α-galactosidase and the enzymatic property analysis of this enzyme

[0182] 1. Genetic engineering expression to obtain α-galactosidase

[0183] 1. Preparation of α-galactosidase coding gene

[0184] With QIAGEN RNeasy Plant Mini kit (RNeasy Plant Mini Kit, Cat.no.74903), extract the total RNA of Aspergillus ustus (CGMCC NO.3.3534); Utilize MBI reverse transcription kit (Fermentas: RevertAid TM First Strand cDNA Synthesis Kit, #K1621) was reverse transcribed to obtain cDNA; using cDNA as a template, PCR amplification was performed with the following primers:

[0185] JYF: (ECOR I) GAATTC ATGTTACTTTCAGTGATCGTCAT (sequence 8)

[0186] JYR: (Not I) GCGGCCGC TTAGTTGCTATAATATGTCCCAT (sequence 9)

[0187] The PCR amplification product was sequenced and identified, and the sequencing result showed that the sequence of the PCR product was shown in SEQID NO.2 in the sequence listing.

[0188] 2. Construction of recomb...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses an Alpha-galactosidase and a coding gene thereof. The alpha-galactosidase is a protein shown in a) or b) as follows: a) a protein consisting of amino acid residue from the 21-438th position of end N in sequence 1 in a sequence table; b) a protein consisting of the amino acid sequence shown in the sequence 1 in the sequence table; or c) a protein that derives from a) or b),has the activity of Alpha-galactosidase and is obtained from the protein limited by a) or b) through substitution and / or loss and / or addition of one or a plurality of amino acid residues. Applied towider industrial production, the enzyme provides experimental materials for the construction of further industrial high-yield engineering strain and also provides comparative sequences and property research reference for richening the diversity research of the source of Alpha-galactosidase. Therefore the enzyme and the coding gene have extremely favorable commercial application value and potential.

Description

technical field [0001] The invention relates to an alpha-galactosidase and its coding gene. Background technique [0002] α-galactosidase (alpha-galactosidase, EC 3.2.1.22) is an enzyme that catalyzes the hydrolysis of α-galactosidic bonds, and is widely distributed in plants, animals and microorganisms. It can not only catalyze α-galactoside oligosaccharides, but also catalyze polysaccharides containing α-galactosidic bonds. The enzyme has broad application prospects in fields such as feed, food, papermaking and pharmaceutical industries. [0003] At present, many microorganisms producing α-galactosidase have been isolated and screened, such as Escherichia coli, Bacillus, Streptomyces, Penicillium, Monascus, Aspergillus oryzae, Aspergillus niger, Aspergillus pylorus, Aspergillus awamori, Mortierella vinodes , Mucor, Rhizopus, Aspergillus flavus, Saccharomyces cerevisiae, etc. Microbial α-galactosidase has a high yield, especially filamentous fungi, which can secrete 30g ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/40C12N15/56C12N15/11C12N15/63C12N1/21C12N1/19C12N5/10C12R1/70C12R1/125C12R1/19
Inventor段文娟杨禄良谢宁李富伟王晓睿李卓夫
OwnerBEIJING CHALLENGE AGRI SCI & TECH CO LTD