Nitrilase gene, vector, engineering bacteria and application thereof

A technology of genetically engineered bacteria and nitrilase, which is applied in the application field of preparing recombinant nitrilase, can solve the problems of no breakthrough, low efficiency, and difficulty in site-directed mutation selection of nitrilase.

Active Publication Date: 2010-04-07
ZHEJIANG UNIV OF TECH
View PDF1 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the difficulty in selecting sites for site-directed mutagenesis, coupled with the long research cycle and low efficiency, there has been no breakthrough in the application of nitrilase.
[0006] In the nitrilase family, due to the low enzyme activity and poor stability of the nitrilase found so far, it is difficult to use nitrilase for large-scale industrial production, which makes the construction of nitrilase gene Engineering bacteria is of great significance. The use of genetic engineering to improve the deficiency of wild-type nitrilase-producing strains provides new ideas and lays the foundation for the industrial application of nitrilase.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nitrilase gene, vector, engineering bacteria and application thereof
  • Nitrilase gene, vector, engineering bacteria and application thereof
  • Nitrilase gene, vector, engineering bacteria and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] The total genomic DNA of Arthrobacter nitroguajacolicus CCTCC No: M 208252 was extracted with a rapid nucleic acid extraction instrument, and the genomic DNA was used as a template to carry out PCR amplification under the action of primer 1 (ATGGATCACCCGAAATTCAAAGC) and primer 2 (AATACCTTCTTGGTCAGTCGGC) . The amount of each component in the PCR reaction system (total volume 50 μL): 5 μL of 10×Pfu DNA Polymerase Buffer, 1 μL of 10 mM dNTP mixture (2.5 mM each of dATP, dCTP, dGTP, and dTTP), 1 μL of cloning primer 1 and primer 2 at a concentration of 50 μM , genomic DNA 1 μL, Pfu DNA Polymerase 1 μL, nucleic acid-free water 40 μL.

[0055] Using Biorad’s PCR instrument, the PCR reaction conditions are: pre-denaturation at 94°C for 5 minutes, then enter the temperature cycle at 94°C for 30s, 53°C for 1min, and 72°C for 1.5min, a total of 30 cycles, and finally extend at 72°C for 10min, and the termination temperature is 8°C .

[0056] Take 5 μL of the PCR reaction soluti...

Embodiment 2

[0058] According to embodiment 1 analysis result design primer 3 (cgc gaattc atggatcacccgaaattcaaagcagc), primer 4 (gtt gtcgac ttaaataccttcttggtcagtcggcag), and introduced EcoRI and SalI restriction enzyme sites in primer 3 and primer 4, respectively. Under the priming of primer 3 and primer 4, high-fidelity Pyrobest DNA polymerase (TaKaRa) was used to amplify to obtain a 819bp nitrilase gene fragment (its nucleotide sequence is shown in SEQ ID NO: 1), After sequencing, the amplified fragment was treated with EcoRI and SalI restriction enzymes (TaKaRa), and the fragment was combined with the commercial vector pTrc99a (Invitrogen) treated with the same restriction enzymes using T4 DNA ligase (TaKaRa). The connection was carried out to construct the expression vector pTrc99a-NIT. The constructed intracellular expression vector pTrc99a-NIT was electrotransformed into Escherichia coli JM109 (Invitrogen), plated and cultured at 37°C overnight, and clones were randomly selected t...

Embodiment 3

[0060] According to embodiment 1 analysis result design primer 5 (cgc gaattc gatcacccgaaattcaaagcagc), primer 6 (att gtcgac aataccttcttggtcagtcggcag), and introduced EcoRI and SalI restriction enzyme sites in primer 5 and primer 6, respectively. Under the priming of primer 5 and primer 6, high-fidelity Pyrobest DNA polymerase (TaKaRa) was used to amplify to obtain a 819bp nitrilase gene fragment, which was sequenced using EcoRI and SalI restriction endonuclease (TaKaRa) The amplified fragment was processed, and the fragment was ligated with the commercialized vector pET20b treated with the same restriction endonuclease using T4 DNA ligase (TaKaRa) to construct the secreted expression vector pET20b-NIT. The constructed expression vector pET20b-NIT was electrotransformed into Escherichia coli BL21 (Invitrogen), plated and cultured overnight at 37°C, clones were randomly picked and plasmids were extracted for enzyme digestion identification. The identification results are shown...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a nitrilase gene coding nitrilase, a recombinant vector containing the gene, a recombinant gene engineering bacteria obtained by converting the recombinant vector and application thereof in preparing recombinant nitrilase. The nitrilase gene can be connected with an expression vector for construction to obtain endoenzyme expression recombinant plasmid containing the gene or secretion expression recombinant plasmid, and then the endoenzyme expression recombinant plasmid containing the gene or the secretion expression recombinant plasmid is respectively and correspondingly converted to a colibacillus bacterial strain to obtain recombinant colibacillus; the recombinant colibacillus contains recombinant nitrilase and can recombine colibacillus into an enzyme resource for biological catalysis and conversion. The recombinant nitrilase serves as the enzyme for conversion, and racemisation mandelonitrile, acrylonitrile, iminodiacetonitrile or 2,2-dimethylcyclopropane carbonitrile and the like serve as a substrate for converting to react and prepare corresponding R-mandelic acid, crylic acid, iminodiacetic acid or chiral 2,2-dimethylcyclopropane formic acid and the like.

Description

(1) Technical field [0001] The invention relates to a nitrilase gene encoding nitrilase, a recombinant vector containing the gene, a recombinant genetically engineered bacterium obtained by transforming the recombinant vector, and its application in preparing the recombinant nitrilase. (2) Background technology [0002] Nitrilase (EC 3.5.5) can catalyze the hydrolysis of nitrile to generate corresponding carboxylic acid and ammonia, which is a kind of hydrolase widely found in nature. Nitrilase is a biocatalyst with a wide range of substrate adaptability. Due to the widespread existence of natural nitrile compounds, it provides and creates favorable conditions for the discovery and utilization of this enzyme capable of degrading nitrile compounds. Nitrilase has stereoselectivity, which can be used to catalyze the synthesis of various optically pure acids. Nitrilase has a high efficiency and single reaction, and its excellent selectivity makes it show great application poten...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/55C12N15/63C12N1/00C12N9/78C12N15/70C12N1/21C12R1/06C12R1/19
Inventor郑裕国柳志强薛亚平郑仁朝沈寅初
OwnerZHEJIANG UNIV OF TECH