Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fluorescent quantization PCR detection method for swine astrovirus

An astrovirus and fluorescence quantitative technology, applied in the field of inspection, can solve the problems of easy cross-contamination operation process, slow detection speed, long time consumption, etc., and achieve the effect of wide detection range, avoidance of pollution, and high throughput.

Inactive Publication Date: 2010-05-12
SHANGHAI JIAO TONG UNIV
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these methods are time-consuming, and have the disadvantages of easy cross-contamination and cumbersome operation, and the detection speed is slow

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent quantization PCR detection method for swine astrovirus
  • Fluorescent quantization PCR detection method for swine astrovirus
  • Fluorescent quantization PCR detection method for swine astrovirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0024] Step one, design primers and Taqman probe

[0025] The genome sequence of porcine Astrovirus was retrieved from the gene database (GEN BANK accession number is AB037272 and Y15938), and the sequence alignment was performed through DNAstar software to obtain the specific conservative sequence of porcine Astrovirus genome (SEQID NO:1);

[0026] The conserved sequence is designed by primer express primer design software and Primer primer5.0 software, and a pair of primer-specific primers and a Taqman probe are obtained. The fluorescent reporter group at the 5'end of the probe is FAM, and the fluorescence at the 3'end is quenched. The quenching group is TAMRA. The primers and probes are located in the ORF2 region, and the target amplified fragment is 155bp.

[0027] Upstream primer: 5'-TCCTTTTGTGGCTTTACTGTGAATG -3'; (SEQ ID NO: 2)

[0028] Downstream primer: 5'-ATGAAGGCAGAAAGCAACTGATAAC -3'; (SEQ ID NO: 3)

[0029] Probe: 5'-(FAM)TGTACCAACCCAGCCAGAGAAGCT(TAMRA)-3'; (SEQ ID NO: 4). ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to a fluorescent quantitation PCR detection method for swine astrovirus, which belongs to the technical field of inspection, which comprises the following steps: step one, using a conservative segment SEQ ID NO:1 of a swine astrovirus gene as a target, designing a primer and a probe, and amplifying a gene segment; step two, constructing recombined plasmid by using the gene segment obtained in the step one; step three, extracting RNA of a sample and reversely transcribing to obtain cDNA; and step four, detecting the content of the swine astrovirus in the sample according to a conventional fluorescent quantization PCR detection method. The method has the characteristics of high sensitivity, high stability, quantifiability, good specificity, low false positive and the like.

Description

Technical field [0001] The invention relates to a detection method in the technical field of detection, in particular to a fluorescent quantitative PCR detection method of porcine astrovirus. Background technique [0002] Astroviruses belong to a new virus family, the Astrovirus family, the genus Astrovirus. The virus was first discovered in 1975 when ApPleton and Hgigins used electron microscopy to detect the stool of children with acute gastroenteritis. The diameter of the virus particle is 28nm. It is named because about 10% of the virus particle has 5-6 star-shaped protrusions on the surface of it can be observed under the electron microscope. Astrovirus is widely distributed all over the world and has been reported to be related to various animal diarrheal diseases such as pigs, dogs, deer, mink, rats, cats, and sheep. Porcine Astrovirus (PAstV) was first observed by Bridger (1980) in 3-week-old piglet diarrhea fecal samples with electron microscopy, and subsequently repor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68
Inventor 崔立华修国郭伟商晓桂单同领
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com