Induction-enhanced tissue specific promoter and application thereof

A tissue-specific, promoter technology, applied in the field of plant genetic engineering, can solve unclear problems and achieve the effect of enhanced expression

Inactive Publication Date: 2010-08-04
WUHAN UNIV
View PDF0 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, only one rice brown planthopper resistance gene, Bph14, has been cloned so far
Therefore, the functions of the BPH-resistant gene promoter, such as whether there is expression specificity, whether it is induced by BPH feeding, etc., are not clear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Induction-enhanced tissue specific promoter and application thereof
  • Induction-enhanced tissue specific promoter and application thereof
  • Induction-enhanced tissue specific promoter and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Isolation and identification of promoters

[0024] When cloning the brown planthopper-resistant gene Bph14 of rice, the inventors sequenced the genome BAC clone of the insect-resistant rice where the gene was located, searched the genome sequence of this segment with the cDNA sequence of Bph14, and selected the transcription start site of the gene The upstream 2kb range was used as a candidate promoter region for PCR amplification. Design primers: F( gaattc tccacccgccgctcctgccc) and R( tctaga tggaaggatcccctagagca), the underline indicates the added restriction site. First, use primers to amplify rice genomic DNA (CTAB method extraction, Zhang QF et al., 1992, Genetic diversity and differentiation of indica and japonica rice detected by RFLPanaysis.Theor.Appl.Genet.83, 495-499) as a template, and the reaction The conditions are: 94°C for 2min; 94°C for 15sec, 58°C for 30sec, 72°C for 2min, 30 cycles; 72°C for 5min). After the PCR product was recovered, i...

Embodiment 2

[0025] Example 2: Identification of promoter expression activity

[0026] The embodiment of the present invention is to construct the GUS gene expression vector of the promoter and transform it into a rice variety, and observe the tissue-specific expression activity of the promoter by GUS color development and tissue section. The specific operation is as follows:

[0027] First, expand the T vector containing the promoter obtained in Example 1, extract the plasmid, and digest it with EcoRI and XbaI. The total volume of the reaction system is 20 μl: about 5 μl (1 μg) of the T vector containing the promoter, 1× reaction buffer Solution, EcoRI and XbaI 0.5U each, mix well, digest overnight at 37°C, and recover the desired fragments by agarose gel electrophoresis. The pCAMBIA1391z vector digestion system is the same as above, and the kit is purified and recovered. The promoter fragment was connected into the pCAMBIA1391z vector, and the reaction system was the same as above. Th...

Embodiment 3

[0030] Example 3: Enhanced expression of rice brown planthopper resistance gene Bph14 induced by feeding on brown planthopper

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an induction-enhanced tissue specific promoter and application thereof, belonging to the technical field of plant genetic engineering. A promoter (BPHP, i.e. Bph14 promoter) for Oryza Sativa L. genes resistant to brown plant hoppers is separated from Oryza Sativa L. and is cloned. The promoter has a nucleotide sequence shown as SEQ ID No. 1, can control Oryza Sativa L. genes resistant to the brown plant hoppers to be specifically expressed in vascular bundle tissues and can be expressed in a way that the feeding induction of the brown plant hoppers is enhanced. The promoter contains BS1EGCCR cis-acting elements and can enable the genes to be specifically expressed in plant vascular bundle tissues. Moreover, the promoter has defense-related response cis-acting elements which can be combined with WRKY transcription factors, and the gene expression is increased when Oryza Sativa L. is fed by the brown plant hoppers or is infected by pathogenic bacteria. The promoter can be used as the promoter for the specific expression in the vascular bundle tissues and can be used as the brown plant hopper and pathogenic bacteria induction-enhanced promoter.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and in particular relates to the isolation, identification and application of a brown planthopper resistance gene promoter in rice. The promoter is named BPHP (that is, Bph14 Promoter), and it is a vascular bundle tissue-specific expression promoter, and its expression is also enhanced by the feeding induction of the brown planthopper. Apply it to study gene expression in vascular tissue. In particular, it is used to study the genetic transformation of important crop resistance to piercing-sucking pests, so as to achieve the purpose of improving plant resistance to insects. Background technique [0002] Rice is an important food crop, which is the staple food for more than half of the world's people. However, in recent decades, rice has been harmed by diseases and insect pests in a large area, which threatens rice production. Brown planthopper is the main pest in rice production in my ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/82
Inventor何光存杜波祝莉莉张维林
OwnerWUHAN UNIV