Induction-enhanced tissue specific promoter and application thereof
A tissue-specific, promoter technology, applied in the field of plant genetic engineering, can solve unclear problems and achieve the effect of enhanced expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1: Isolation and identification of promoters
[0024] When cloning the brown planthopper-resistant gene Bph14 of rice, the inventors sequenced the genome BAC clone of the insect-resistant rice where the gene was located, searched the genome sequence of this segment with the cDNA sequence of Bph14, and selected the transcription start site of the gene The upstream 2kb range was used as a candidate promoter region for PCR amplification. Design primers: F( gaattc tccacccgccgctcctgccc) and R( tctaga tggaaggatcccctagagca), the underline indicates the added restriction site. First, use primers to amplify rice genomic DNA (CTAB method extraction, Zhang QF et al., 1992, Genetic diversity and differentiation of indica and japonica rice detected by RFLPanaysis.Theor.Appl.Genet.83, 495-499) as a template, and the reaction The conditions are: 94°C for 2min; 94°C for 15sec, 58°C for 30sec, 72°C for 2min, 30 cycles; 72°C for 5min). After the PCR product was recovered, i...
Embodiment 2
[0025] Example 2: Identification of promoter expression activity
[0026] The embodiment of the present invention is to construct the GUS gene expression vector of the promoter and transform it into a rice variety, and observe the tissue-specific expression activity of the promoter by GUS color development and tissue section. The specific operation is as follows:
[0027] First, expand the T vector containing the promoter obtained in Example 1, extract the plasmid, and digest it with EcoRI and XbaI. The total volume of the reaction system is 20 μl: about 5 μl (1 μg) of the T vector containing the promoter, 1× reaction buffer Solution, EcoRI and XbaI 0.5U each, mix well, digest overnight at 37°C, and recover the desired fragments by agarose gel electrophoresis. The pCAMBIA1391z vector digestion system is the same as above, and the kit is purified and recovered. The promoter fragment was connected into the pCAMBIA1391z vector, and the reaction system was the same as above. Th...
Embodiment 3
[0030] Example 3: Enhanced expression of rice brown planthopper resistance gene Bph14 induced by feeding on brown planthopper
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
