Alpha D globin gene as chicken molecular mark with high oxygen carrying capability as well as detection method and application thereof
A molecular marker and globin technology, applied in the application, genetic engineering, plant genetic improvement and other directions, can solve the problems of lack of chicken hypoxia tolerance molecular markers, inability to carry out hypoxia tolerance marker-assisted selection, etc., to solve the technical bottleneck Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1 uses α D Globin gene as molecular marker of high oxygen-carrying capacity of chicken and preparation method thereof
[0027] (1) Primer design: design α for amplification D Primer pair for the globin gene as a molecular marker of high oxygen-carrying capacity in chicken, according to Chicken α at Genbank accession number AY016020 D The globin gene sequence design primer, the DNA sequence of the primer pair of described design is as follows:
[0028] Forward primer F: 5'GCTGCCACCATGCTGACTGC 3' (shown in the sequence table as SEQ ID NO: 2)
[0029] Reverse primer R: 5'AACCCCAAGATCCCCTGACCTGAG 3' (as shown in SEQ ID NO: 3 in the sequence listing).
[0030] The above primers were sent to Shanghai Sangon Bioengineering Co., Ltd. for synthesis.
[0031] (2) PCR amplification and sequencing of chicken genomic DNA: sample 1 is chicken genomic DNA extracted from the blood of a Tibetan chicken directly from Shangri-La County, Diqing Prefecture, Yunnan Province, Chin...
Embodiment 2
[0037] Embodiment 2 detects with α D The globin gene as a molecular marker of high oxygen-carrying capacity in chickens
[0038] (1) Extraction of chicken genomic DNA: the sample genomic DNA was extracted by conventional phenol / chloroform method.
[0039] (2) PCR amplification of chicken genomic DNA: use the primers designed and synthesized in Example 1 to carry out PCR amplification in the sample genomic DNA to be tested, PCR reaction system 25 μ L, the concentration of each component in the system is: 50ng template DNA, 1×Taq buffer 2.5mmol / L, 1.5mmol / L MgCl 2 , 2.5mmol / L dNTPs, 0.5mmol / L PCR primers and 2U TaqDNA polymerase (MBI), the PCR operation program is as follows: pre-denaturation at 94°C for 4min; 94°C for 45s, 58°C for 40s, 72°C for 40s, 35 cycles; Finally, the extension was continued at 72°C for 10 min.
[0040] (3) Digestion of PCR products: Take the PCR product of the sample to be tested and add restriction endonuclease BSEG I 0.5μl (10U / μl), 10×Buffer 1μl an...
Embodiment 3
[0042] Example 3 The application of the molecular marker screened by the present invention in the detection of polymorphisms in different chicken populations and wild ring-necked pheasants
[0043] Tibetan chickens (from different altitudes in Tibetan areas of my country, see Table 1) and lowland recessive white-feathered broiler chickens, Banna gamecocks, camellia chickens, Beijing oil chickens, Guangxi three-yellow chickens and lowland wild ring-necked pheasants were selected as experimental materials (except Tibetan chickens The other materials are all from the practice chicken farm of Yunnan Agricultural University, see Table 1), and the detection of chicken α D The polymorphism distribution frequency of the second exon of the globin gene PCR-BSEG I-RFLP is detected by the method described in Example 2, and the detection results are shown in Table 2. Table 2 shows that: altitude increases, α D There is a corresponding increase in the frequency of the mutated gene. Above the...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 