Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Alpha D globin gene as chicken molecular mark with high oxygen carrying capability as well as detection method and application thereof

A molecular marker and globin technology, applied in the application, genetic engineering, plant genetic improvement and other directions, can solve the problems of lack of chicken hypoxia tolerance molecular markers, inability to carry out hypoxia tolerance marker-assisted selection, etc., to solve the technical bottleneck Effect

Inactive Publication Date: 2010-09-08
YUNNAN AGRICULTURAL UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The technical problem to be solved by the present invention is to overcome the plateau hypoxic bottleneck encountered in the process of breeding Tibetan excellent hybrid chickens with plateau adaptability. In the prior art, there are no molecular markers related to chicken hypoxic tolerance, resulting in the inability to develop Marker-assisted selection associated with hypoxic tolerance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Alpha D globin gene as chicken molecular mark with high oxygen carrying capability as well as detection method and application thereof
  • Alpha D globin gene as chicken molecular mark with high oxygen carrying capability as well as detection method and application thereof
  • Alpha D globin gene as chicken molecular mark with high oxygen carrying capability as well as detection method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 uses α D Globin gene as molecular marker of high oxygen-carrying capacity of chicken and preparation method thereof

[0027] (1) Primer design: design α for amplification D Primer pair for the globin gene as a molecular marker of high oxygen-carrying capacity in chicken, according to Chicken α at Genbank accession number AY016020 D The globin gene sequence design primer, the DNA sequence of the primer pair of described design is as follows:

[0028] Forward primer F: 5'GCTGCCACCATGCTGACTGC 3' (shown in the sequence table as SEQ ID NO: 2)

[0029] Reverse primer R: 5'AACCCCAAGATCCCCTGACCTGAG 3' (as shown in SEQ ID NO: 3 in the sequence listing).

[0030] The above primers were sent to Shanghai Sangon Bioengineering Co., Ltd. for synthesis.

[0031] (2) PCR amplification and sequencing of chicken genomic DNA: sample 1 is chicken genomic DNA extracted from the blood of a Tibetan chicken directly from Shangri-La County, Diqing Prefecture, Yunnan Province, Chin...

Embodiment 2

[0037] Embodiment 2 detects with α D The globin gene as a molecular marker of high oxygen-carrying capacity in chickens

[0038] (1) Extraction of chicken genomic DNA: the sample genomic DNA was extracted by conventional phenol / chloroform method.

[0039] (2) PCR amplification of chicken genomic DNA: use the primers designed and synthesized in Example 1 to carry out PCR amplification in the sample genomic DNA to be tested, PCR reaction system 25 μ L, the concentration of each component in the system is: 50ng template DNA, 1×Taq buffer 2.5mmol / L, 1.5mmol / L MgCl 2 , 2.5mmol / L dNTPs, 0.5mmol / L PCR primers and 2U TaqDNA polymerase (MBI), the PCR operation program is as follows: pre-denaturation at 94°C for 4min; 94°C for 45s, 58°C for 40s, 72°C for 40s, 35 cycles; Finally, the extension was continued at 72°C for 10 min.

[0040] (3) Digestion of PCR products: Take the PCR product of the sample to be tested and add restriction endonuclease BSEG I 0.5μl (10U / μl), 10×Buffer 1μl an...

Embodiment 3

[0042] Example 3 The application of the molecular marker screened by the present invention in the detection of polymorphisms in different chicken populations and wild ring-necked pheasants

[0043] Tibetan chickens (from different altitudes in Tibetan areas of my country, see Table 1) and lowland recessive white-feathered broiler chickens, Banna gamecocks, camellia chickens, Beijing oil chickens, Guangxi three-yellow chickens and lowland wild ring-necked pheasants were selected as experimental materials (except Tibetan chickens The other materials are all from the practice chicken farm of Yunnan Agricultural University, see Table 1), and the detection of chicken α D The polymorphism distribution frequency of the second exon of the globin gene PCR-BSEG I-RFLP is detected by the method described in Example 2, and the detection results are shown in Table 2. Table 2 shows that: altitude increases, α D There is a corresponding increase in the frequency of the mutated gene. Above the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an alpha D globin gene as a chicken molecular mark with high oxygen carrying capability as well as a detection method and application thereof, belonging to the technical field of auxiliary selection of chicken genetic markers. The nucleotide sequence of the molecular mark provided by the invention is shown as SEQ ID No: 1, wherein the 251 bp in the sequence has an A / C base mutation which is recorded as A251C and causes BSEG I-RFLP Polymorphism. The sequence of a primer for amplifying the molecular marker is shown as SEQ ID No: 2 and SEQ ID No: 3. The method for detecting the molecular marker comprises the steps of extraction of chicken genome DNA in a sample to be detected, PCR amplification and the enzyme digestion of a restriction enzyme BSEGI of the PCR product. When the genotype of a chicken individual to be detected is CC type (478bp+35bp), the chicken individual has high oxygen carrying capability. The invention provides the effective molecule marker for breeding excellent cross-fertilizer chickens which adapt to high altitude hypoxia environments and has high yield and high quality.

Description

technical field [0001] The invention belongs to the technical field of genetic (molecular) marker-assisted selection of chickens, and in particular relates to a molecular marker and a primer for chicken plateau hypoxia adaptation, and a method for detecting high oxygen-carrying capacity of chickens with the molecular marker and its application. Background technique [0002] Tibetan chicken is a relatively closed breed of chicken that has the longest time to adapt to the plateau and the strongest adaptability in the world. It has been included in the first batch of protected livestock and poultry breed resources. Tibetan chicken refers to the only indigenous breed from Tibetan areas. Tibetan chicken has the characteristics of strong adaptability, resistance to rough feeding, strong foraging ability in the wild, and strong disease resistance. The adaptation of Tibetan chickens to plateau is multi-level and multi-linked, and its embryonic hypoxia adaptability is much higher th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C12N15/11C12N15/10C12Q1/68
Inventor 苟潇吴常信杨舒黎张浩魏泽辉严达伟赵桂英韩树鑫李帅
Owner YUNNAN AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com