Dengue virus and Japanese encephalitis virus embedded pseudo virus particle vaccine and preparation method thereof

A technology of dengue virus and encephalitis virus, applied in the field of dengue virus-Japanese encephalitis virus chimeric pseudovirus as a vaccine research field, can solve the problems of poor effect and lack of particle structure of chimeric protein, so as to improve production efficiency , the effect of reducing risks and reducing product production costs

Active Publication Date: 2012-05-23
ARMY MEDICAL UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But the chimeric protein lacks the virus-like particle structure and is not as effective as the full virus particle

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Dengue virus and Japanese encephalitis virus embedded pseudo virus particle vaccine and preparation method thereof
  • Dengue virus and Japanese encephalitis virus embedded pseudo virus particle vaccine and preparation method thereof
  • Dengue virus and Japanese encephalitis virus embedded pseudo virus particle vaccine and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 2

[0068] After obtaining the recombinant expression plasmid, a conventional method is to introduce it into target cells, cultivate the transfected cells, and collect the culture supernatant after a period of time (such as 48 hours), and obtain the chimeric pseudovirus by ultracentrifugation. Another preferred method is to use the antibiotic (such as G418) corresponding to the resistance gene carried by the plasmid to screen the cells transfected with the plasmid to obtain a cell clone with stable resistance, and then cultivate the clone for a period of time (such as 48 hours). Afterwards, the culture supernatant was collected and centrifuged to obtain chimeric pseudovirus particles.

Embodiment 1

[0069] Example 1 Construction of chimeric pseudovirus recombinant expression plasmid

[0070] 1. Preparation of Flavivirus Signal Peptide Coding Sequence (S Fragment)

[0071] (1) Design a pair of oligonucleotide fragments according to the Japanese encephalitis virus signal peptide sequence shown in SEQ NO (Davis BS etal, J Virol 2001, 75 (9): 4040-4047): S1: ATAGGCTAGCGCCATGGGCAAGAGATCGGCGGGCTCAATCATGTGGCTCGCAAGCTTGG (SEQ ID No: 5), S2: GCGTGTGGTTAAATGGAATGCTCCTGCGTAAGCTATGACAACTGCCAAGCTTGCGAGC (SEQ ID No: 6), synthesized by the DNA Synthesis Department of Dalian TakaRa Company;

[0072] (2) Synthesis of S fragment by primer extension method (the 5' end of S1 chain has an EheI restriction site): because the 3' end of S1 and S2 oligonucleotide fragments is designed with a 14bp complementary sequence, the primer extension method can be used The S fragment is generated, and the amino acid sequence encoded by the fragment is shown in SEQ ID No:2. The specific operation is: prep...

Embodiment 3

[0138] The preparation process of embodiment 3 chimeric pseudovirion vaccine

[0139] 1. recover the stable transfected clone obtained in Example 2, use the DMEM medium containing 10% calf serum to expand the culture, after reaching the required cell amount, use the DMEM medium culture of 2% calf serum instead, Collect the supernatant once every 48 hours, centrifuge at 6000 g for 30 minutes (Sigma 3T3 centrifuge), and save the supernatant.

[0140] 2. Centrifugal purification of chimeric pseudovirus particles: add PEG8000 (Shanghai Shenggong, final concentration is 7.1%) and NaCl (Shanghai Shenggong, final concentration is 2.7%) in culture supernatant, shake overnight at 4 ℃ (16 -20 hours), centrifuge at 50000g at 4°C for 1 hour, and resuspend the pellet with 1 / 100 volume of TNE buffer (10mM Tris, 1mM EDTA, 100mM NaCl, pH 8.0) to make a concentrated virus solution.

[0141] The preparation of TNE buffer is as follows: Weigh 1.21g Tris (Shanghai Sangong), 0.37g EDTA (Shanghai ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a dengue virus and Japanese encephalitis virus embedded pseudo virus particle vaccine and a preparation method thereof. The embedded pseudo virus particles are formed by transfectting and expressing recombinant expression plasmids of a cloned dengue virus and Japanese encephalitis virus structural gene in target cells. The preparation method of the embedded pseudo virus comprises the following steps of: (1) constructing the recombinant expression plasmids containing a dengue virus-Japanese encephalitis virus structural protein coding sequence; (2) introducing the recombinant plasmid into the target cells and sieving stably-transfectted cells for cloning; (3) culturing the stably-transfectted cells so as to generate dengue virus-Japanese encephalitis virus embeddedpseudo virus particles; and (4) extracting and purifying the embedded pseudo virus particles from cell culture supernatant fluid. The vaccine embedded with the dengue virus-Japanese encephalitis virus antigens can stimulate the organism to generate immune response, further prevents dengue virus and / or Japanese encephalitis virus infectious diseases, and has the advantages of good immune effect, safety and industrial production suitability.

Description

technical field [0001] The invention relates to a dengue virus-Japanese encephalitis virus chimeric pseudovirus and a preparation method thereof, and also relates to the application of the dengue virus-Japanese encephalitis virus chimeric pseudovirus in vaccine research. Background technique [0002] Dengue virus (Dengue virus, DV) and Japanese encephalitis virus (known internationally as Japanese encephalitis virus, Japanese encephalitis virus, JEV) are both single-stranded positive-sense RNA viruses of the Flaviviridae family, which use mosquitoes as vectors to propagate. Dengue fever (Dengue fever, DF), dengue hemorrhagic fever and dengue shock syndrome (Dengue hemorrhagic fever / Dengue shock syndrome, DHF / DSS) caused by DV are widely prevalent in tropical and subtropical regions, with 2.5 to 3 billion people living in the world. In endemic areas, more than 100 million people are infected every year, and about 1 million people develop severe DHF / DSS, with a mortality rate...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/63C12N15/62C12N15/40C12N7/04A61K39/295A61P31/14A61P25/00
CPCY02A50/30
Inventor 饶贤才胡福泉胡珍朱军民陈志瑾杨杰
Owner ARMY MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap