Unlock instant, AI-driven research and patent intelligence for your innovation.

Vibrio paraheamolyticus bivalent DNA vaccine as well as preparation method and application thereof

A technology of DNA vaccine and vibrio hemolyticus, applied in the direction of recombinant DNA technology, DNA/RNA fragments, antibacterial drugs, etc., can solve the problem of low immune protection rate of DNA vaccine

Inactive Publication Date: 2011-01-19
OCEAN UNIV OF CHINA
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the immune protection rate of DNA vaccines is still low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vibrio paraheamolyticus bivalent DNA vaccine as well as preparation method and application thereof
  • Vibrio paraheamolyticus bivalent DNA vaccine as well as preparation method and application thereof
  • Vibrio paraheamolyticus bivalent DNA vaccine as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Embodiment 1: Construction of the prokaryotic expression of the tdh2-vps fusion gene protein set-up vector pET28a-tdh2-vps:

[0050] 1. Genomic DNA extraction:

[0051] 1. Take a single colony of Vibrio parahaemolyticus FYZ8621.4, insert it into 5ml 2216E liquid medium, and culture it with shaking at 28°C for 24 hours;

[0052] 3. Centrifuge the cultured bacterial solution at 12000 rpm for 2 minutes to collect the bacterial cells;

[0053] 3. Using the phenol-chloroform extraction method to extract the genomic DNA of Vibrio parahaemolyticus.

[0054] Two, PCR reaction obtains the method for gene tdh2 and gene vps:

[0055] 1. Preparation of gene tdh2:

[0056] (1) According to the sequence of the thermostable hemolysin subunit gene tdh2 of Vibrio parahaemolyticus included in GeneBank, a pair of primers a for amplifying the gene tdh2 was designed, and its sequence is:

[0057] 5′CGCGGATCCATGAAGTACCGATATTTTGCA 3′

[0058] 5′CGCGAATTCTTGTTGATGTTTACATTCAAAA 3′

[0059...

Embodiment 2

[0097] Example 2: Construction of tdh2-vps fusion gene protein eukaryotic expression vector pEGFP-N1-tdh2-vps:

[0098] 1. The tdh2-vps fusion gene connected together is used as a separate gene, and the above-mentioned prokaryotic expression vector pET28a-tdh2-vps is used as a template to redesign a pair of primers c used to amplify the tdh2-vps fusion gene, which The sequence is:

[0099] 5'CGCCTCGAGATGAAGTACCGATATTTTGCA 3'

[0100] 5'CGCGGATCCCCTTAGTGGCCAAAGATACGCAT 3'

[0101] 2. Using pET28a-tdh2-vps as a template, carry out PCR reaction to obtain a 2355bp PCR product. The reaction conditions are: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 1 minute, annealing at 58°C for 1 minute, extension at 72°C for 2 minutes and 30 seconds; 30 cycles of this reaction; and extension at 72°C for 10 minutes.

[0102] The reaction system is: 5 μl of Buffer, 3 μl of MgCl 2 , 0.5 μl of dNTP, 0.5 μl of Taq enzyme, 2 μl of template DNA, 0.5 μl of each primer c, and fi...

Embodiment 3

[0107] Example 3: Preparation and use of bivalent DNA vaccine suspension

[0108] Transform the pEGFP-N1-tdh2-vps engineering vector obtained in the above Example 2 into Escherichia coli DH5α, and after culturing in LB liquid medium containing kanamycin for 12-18 hours, extract the engineering vector pEGFP-N1-tdh2 -vps, after the carrier is subjected to endotoxin removal treatment, the carrier is dissolved in 0.05mol / L phosphate buffer saline PBS to a concentration of 200ug / ml to obtain a Vibrio parahaemolyticus bivalent DNA vaccine suspension. to immunize fish. Take farmed flounder fish as an example. Two weeks before the immunization experiment, the same batch of healthy flounder was purchased and kept in a water tank with ventilation and normal water changes and baiting, the water temperature was ~20°C. The engineering vector pEGFP-N1-tdh2-vps prepared by the present invention is used to immunize flounder by intramuscular injection, the injection site is the thicker muscl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a vibrio paraheamolyticus bivalent DNA vaccine as well as a preparation method and application thereof. The vibrio paraheamolyticus bivalent DNA vaccine is characterized in that a vibrio paraheamolyticus tdh2 gene and a vps gene are connected through 6 nucleotides to form a tdh2-vps fusion gene protein eukaryotic expression engineering vector vaccine. The preparation method of the vibrio paraheamolyticus bivalent DNA vaccine comprises the following steps of connecting the gene tdh2 and the gene vps by utilizing a double digestion technology after a cohesive end is obtained, and cloning into a prokaryotic expression vector pET28a to construct a fusion gene protein prokaryotic expression engineering vector; through the double digestion technology, inserting the fusion gene into a eukaryotic vector to construct a fusion gene protein eukaryotic expression engineering vector; finally, using a conventional method to prepare a vibrio paraheamolyticus bivalent DNA vaccine suspension. The invention has the advantages of strong operability, high repetition rate, safety without toxic and side effects, double immune protection on fish and higher immune effect than that of an inactivated vaccine, a recombinant protein vaccine and a monovalent DNA vaccine.

Description

technical field [0001] The invention belongs to the vaccine and its preparation technology in the field of biotechnology, and relates to genetic engineering and immunology. Specifically, it relates to the preparation method and application of the vibrio parahaemolyticus bivalent DNA vaccine. Background technique [0002] Vibrio parahaemolyticus (Vibrio parahaemolyticus) is a Gram-negative bacterium that is widely distributed in coastal seawater environments and can infect various aquatic animals such as seawater fish, prawns, and crustaceans. The main pathogenic bacteria in the world cause significant economic losses to the aquaculture industry every year. The fungus is also the main pathogen of seafood food poisoning and acute diarrhea in coastal areas in summer and autumn. The main pathogenic factors of Vibrio parahaemolyticus are hemolysin and serine protease. [0003] Currently prepared Vibrio parahaemolyticus vaccines mainly include whole-bacteria inactivated vaccine...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K48/00A61K39/106C12N15/62C12N15/63A61P31/04
Inventor 陈吉祥刘瑞何庆芳徐广峰
Owner OCEAN UNIV OF CHINA