Vibrio paraheamolyticus bivalent DNA vaccine as well as preparation method and application thereof
A technology of DNA vaccine and vibrio hemolyticus, applied in the direction of recombinant DNA technology, DNA/RNA fragments, antibacterial drugs, etc., can solve the problem of low immune protection rate of DNA vaccine
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Embodiment 1: Construction of the prokaryotic expression of the tdh2-vps fusion gene protein set-up vector pET28a-tdh2-vps:
[0050] 1. Genomic DNA extraction:
[0051] 1. Take a single colony of Vibrio parahaemolyticus FYZ8621.4, insert it into 5ml 2216E liquid medium, and culture it with shaking at 28°C for 24 hours;
[0052] 3. Centrifuge the cultured bacterial solution at 12000 rpm for 2 minutes to collect the bacterial cells;
[0053] 3. Using the phenol-chloroform extraction method to extract the genomic DNA of Vibrio parahaemolyticus.
[0054] Two, PCR reaction obtains the method for gene tdh2 and gene vps:
[0055] 1. Preparation of gene tdh2:
[0056] (1) According to the sequence of the thermostable hemolysin subunit gene tdh2 of Vibrio parahaemolyticus included in GeneBank, a pair of primers a for amplifying the gene tdh2 was designed, and its sequence is:
[0057] 5′CGCGGATCCATGAAGTACCGATATTTTGCA 3′
[0058] 5′CGCGAATTCTTGTTGATGTTTACATTCAAAA 3′
[0059...
Embodiment 2
[0097] Example 2: Construction of tdh2-vps fusion gene protein eukaryotic expression vector pEGFP-N1-tdh2-vps:
[0098] 1. The tdh2-vps fusion gene connected together is used as a separate gene, and the above-mentioned prokaryotic expression vector pET28a-tdh2-vps is used as a template to redesign a pair of primers c used to amplify the tdh2-vps fusion gene, which The sequence is:
[0099] 5'CGCCTCGAGATGAAGTACCGATATTTTGCA 3'
[0100] 5'CGCGGATCCCCTTAGTGGCCAAAGATACGCAT 3'
[0101] 2. Using pET28a-tdh2-vps as a template, carry out PCR reaction to obtain a 2355bp PCR product. The reaction conditions are: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 1 minute, annealing at 58°C for 1 minute, extension at 72°C for 2 minutes and 30 seconds; 30 cycles of this reaction; and extension at 72°C for 10 minutes.
[0102] The reaction system is: 5 μl of Buffer, 3 μl of MgCl 2 , 0.5 μl of dNTP, 0.5 μl of Taq enzyme, 2 μl of template DNA, 0.5 μl of each primer c, and fi...
Embodiment 3
[0107] Example 3: Preparation and use of bivalent DNA vaccine suspension
[0108] Transform the pEGFP-N1-tdh2-vps engineering vector obtained in the above Example 2 into Escherichia coli DH5α, and after culturing in LB liquid medium containing kanamycin for 12-18 hours, extract the engineering vector pEGFP-N1-tdh2 -vps, after the carrier is subjected to endotoxin removal treatment, the carrier is dissolved in 0.05mol / L phosphate buffer saline PBS to a concentration of 200ug / ml to obtain a Vibrio parahaemolyticus bivalent DNA vaccine suspension. to immunize fish. Take farmed flounder fish as an example. Two weeks before the immunization experiment, the same batch of healthy flounder was purchased and kept in a water tank with ventilation and normal water changes and baiting, the water temperature was ~20°C. The engineering vector pEGFP-N1-tdh2-vps prepared by the present invention is used to immunize flounder by intramuscular injection, the injection site is the thicker muscl...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 