Vibrio paraheamolyticus bivalent DNA vaccine as well as preparation method and application thereof

A technology of DNA vaccine and vibrio hemolyticus, applied in the direction of recombinant DNA technology, DNA/RNA fragments, antibacterial drugs, etc., can solve the problem of low immune protection rate of DNA vaccine

Inactive Publication Date: 2011-01-19
OCEAN UNIV OF CHINA
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the immune protection r

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vibrio paraheamolyticus bivalent DNA vaccine as well as preparation method and application thereof
  • Vibrio paraheamolyticus bivalent DNA vaccine as well as preparation method and application thereof
  • Vibrio paraheamolyticus bivalent DNA vaccine as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0049] Example 1: Construction of the prokaryotic expression vector pET28a-tdh2-vps of the tdh2-vps fusion gene protein:

[0050] 1. Extract genomic DNA:

[0051] 1. Take a single colony of Vibrio parahaemolyticus FYZ8621.4, connect it to 5ml 2216E liquid medium, and culture it with shaking at 28°C for 24 hours;

[0052] 3. Centrifuge the cultured bacteria liquid at 12000 rpm for 2 minutes to collect the bacteria;

[0053] 3. Extract the genomic DNA of Vibrio parahaemolyticus by phenol-chloroform extraction method.

[0054] 2. Methods to obtain gene tdh2 and gene vps by PCR reaction:

[0055] 1. Preparation of gene tdh2:

[0056] (1) According to the sequence of the thermostable hemolysin subunit gene tdh2 of Vibrio parahaemolyticus included in GeneBank, a pair of primers a for amplifying the gene tdh2 was designed. The sequence is:

[0057] 5′CGCGGATCCATGAAGTACCGATATTTTGCA 3′

[0058] 5′CGCGAATTCTTGTTGATGTTTACATTCAAAA 3′

[0059] (2) Using the genomic DNA of Vibrio parahaemolyticus extracte...

Example Embodiment

[0097] Example 2: Construction of the eukaryotic expression vector pEGFP-N1-tdh2-vps of the tdh2-vps fusion gene protein:

[0098] 1. Take the linked tdh2-vps fusion gene as a separate gene, and use the above-mentioned prokaryotic expression vector pET28a-tdh2-vps as a template to redesign a pair of primers c used to amplify the tdh2-vps fusion gene. The sequence is:

[0099] 5’CGCCTCGAGATGAAGTACCGATATTTTGCA 3’

[0100] 5’CGCGGATCCCCTTAGTGGCCAAAGATACGCAT 3’

[0101] 2. Use pET28a-tdh2-vps as a template to perform PCR reaction to obtain a 2355bp PCR product. The reaction conditions are: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 1 minute, annealing at 58°C for 1 minute, and extension at 72°C for 2 minutes and 30 seconds; 30 cycles of such reaction; and then extension at 72°C for 10 minutes.

[0102] The reaction system is: 5μl Buffer, 3μl MgCl 2 , 0.5μl of dNTP, 0.5μl of Taq enzyme, 2μl of template DNA, 0.5μl of primer c each, and finally make up 50μl with sterile...

Example Embodiment

[0107] Example 3: Preparation and use of bivalent DNA vaccine suspension

[0108] The pEGFP-N1-tdh2-vps engineering vector obtained in the above example 2 was transformed into E. coli DH5α, and after culturing in LB liquid medium containing kanamycin for 12-18 hours, the engineering vector pEGFP-N1-tdh2 was extracted -vps: After removing endotoxin treatment on this vector, dissolve the vector in 0.05mol / L phosphate buffer PBS to a concentration of 200ug / ml to obtain the bivalent DNA vaccine suspension of Vibrio parahaemolyticus. Can be immune to fish. Take the farmed flounder as an example. Two weeks before the immunization experiment, the same batch of healthy flounder was purchased, raised in a water tank, aerated, and the water was changed normally, and the bait was fed at a temperature of ~20°C. The engineering vector pEGFP-N1-tdh2-vps prepared by the invention is used for intramuscular injection immunization of Japanese flounder, the injection site is a thicker place near ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a vibrio paraheamolyticus bivalent DNA vaccine as well as a preparation method and application thereof. The vibrio paraheamolyticus bivalent DNA vaccine is characterized in that a vibrio paraheamolyticus tdh2 gene and a vps gene are connected through 6 nucleotides to form a tdh2-vps fusion gene protein eukaryotic expression engineering vector vaccine. The preparation method of the vibrio paraheamolyticus bivalent DNA vaccine comprises the following steps of connecting the gene tdh2 and the gene vps by utilizing a double digestion technology after a cohesive end is obtained, and cloning into a prokaryotic expression vector pET28a to construct a fusion gene protein prokaryotic expression engineering vector; through the double digestion technology, inserting the fusion gene into a eukaryotic vector to construct a fusion gene protein eukaryotic expression engineering vector; finally, using a conventional method to prepare a vibrio paraheamolyticus bivalent DNA vaccine suspension. The invention has the advantages of strong operability, high repetition rate, safety without toxic and side effects, double immune protection on fish and higher immune effect than that of an inactivated vaccine, a recombinant protein vaccine and a monovalent DNA vaccine.

Description

technical field [0001] The invention belongs to the vaccine and its preparation technology in the field of biotechnology, and relates to genetic engineering and immunology. Specifically, it relates to the preparation method and application of the vibrio parahaemolyticus bivalent DNA vaccine. Background technique [0002] Vibrio parahaemolyticus (Vibrio parahaemolyticus) is a Gram-negative bacterium that is widely distributed in coastal seawater environments and can infect various aquatic animals such as seawater fish, prawns, and crustaceans. The main pathogenic bacteria in the world cause significant economic losses to the aquaculture industry every year. The fungus is also the main pathogen of seafood food poisoning and acute diarrhea in coastal areas in summer and autumn. The main pathogenic factors of Vibrio parahaemolyticus are hemolysin and serine protease. [0003] Currently prepared Vibrio parahaemolyticus vaccines mainly include whole-bacteria inactivated vaccine...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A61K48/00A61K39/106C12N15/62C12N15/63A61P31/04
Inventor 陈吉祥刘瑞何庆芳徐广峰
Owner OCEAN UNIV OF CHINA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap