Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

New streptomyces secretion expression plasmid and application thereof

A Streptomyces and expression vector technology, applied in the fields of molecular biology and genetic engineering, can solve the problems of cumbersome operation, inconvenience and practicality, etc.

Inactive Publication Date: 2011-04-06
MEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the plasmid has not been fully optimized yet. It does not contain the E. coli plasmid replicon and the conjugative transfer element oriT. It can only be cloned by protoplast transformation to clone foreign genes in Streptomyces. The operation is cumbersome; there is no convenient and practical multi-cloning site to clone the exogenous gene that needs to be expressed; there is no promoter necessary for the expression of the exogenous gene; there is no signal peptide necessary for the secretion and expression of the exogenous gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • New streptomyces secretion expression plasmid and application thereof
  • New streptomyces secretion expression plasmid and application thereof
  • New streptomyces secretion expression plasmid and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1p

[0060] The construction process of embodiment 1 pIMB4

[0061] 1. Selection of expression vector Streptomyces replication region

[0062] Digest pSGL1 with SalI and SacI, recover a small fragment containing the smallest replicon, and connect it to pUC19-E [pUC19 (Kieser T, BibbMJ, Buttner MJ, Chater KF, Hopwood DA, which is also digested with SalI and SacI : Practical StreptomycesGenitics, 2000) the EcoR I site was artificially deleted] on the vector, to obtain plasmid pUC19-E / SG ( Figure 1A ).

[0063] 2. Acquisition of resistance genes, ori, the origin of replication in Escherichia coli, and ori T, an essential region for conjugative transfer in Streptomyces

[0064] The E. coli origin of replication ori and the ampicillin resistance gene bla are derived from the pBluescript II KS+ plasmid (Kieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA: Practical Streptomyces Genitics, 2000), essential regions for conjugative transfer in Streptomyces oriT and apramycin resistance...

Embodiment 2

[0085] Cloning and expression of embodiment 2IL6 in novel streptomyces expression vector pIMB3, pIMB4

[0086] 1 Construction of IL6 recombinant expression strain

[0087] According to the known human IL6 gene coding sequence, two primers IL6a and IL6b were designed,

[0088] IL6a: 5'TCCATATGGTACCCCCCAGGAGAAGATTC 3' (SEQ ID NO: 8)

[0089] IL6b: 5'CGGGATCCTTACATTTGCCGAAGAGCCTC 3' (SEQ ID NO: 9)

[0090] An Nde I restriction site was added to the 5' end of the upstream primer IL6a, a BamH I restriction site was added to the 5' end of the downstream primer IL6b, and a stop codon TAA was introduced before the restriction site. Pfu high-fidelity DNA polymerase was used for PCR, and the cDNA reverse-transcribed from the total RNA of human peripheral blood mononuclear cells was used as a template. The PCR amplification conditions were: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 1 minute, and annealing at 55°C 40 seconds, 72°C extension for 2 minutes, 30 cy...

Embodiment 3

[0102] Example 3 Purification and Biological Activity Verification of Recombinant Human IL6

[0103] 1. Prediction of physical and chemical properties and structure of IL6

[0104] Before purifying the protein, first conduct a preliminary analysis of the properties of the target protein, mainly including molecular weight and isoelectric point. We used the protein sequence analysis software package ANTHREPORT 5.0 to predict the physical and chemical properties of IL6 expressed in Example 2 S.lividans[pIMB4-IL6]. The molecular weight of the IL6 protein is 20813.87, and the isoelectric point pI=6.175; the entire molecule is hydrophobic and hydrophilic. The structure; the protein is completely soluble; no transmembrane structure.

[0105] 2. Isolation and purification of recombinant human IL6 expressed by Streptomyces

[0106] We choose strong cation exchange resin Q Sepharose Fast Flow as the separation medium, and the pH of the ion exchange starting buffer is more than 2 uni...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a new streptomyces secretion expression plasmid and application thereof. The new streptomyces secretionexpression plasmid is particularly characterized by being cloned with a colon bacillus replication original region ori, a streptomyces conjugational-transfer essential region oriT, a penbritin resistance gene bla, an apramycin resistance gene aac (3) IV, a promoter ermE*p, a lidamycin prosthetic-group protein gene promoter cagAp, a lidamycin prosthetic-group protein gene mutation type signal peptide SPcagA (CTG) and multiple cloning sites by taking a minimum replicon of a pSGL1 plasmid naturally existing in streptomyces globisporus C-1027 as a framework. The new streptomyces secretory expression plasmid can be used for efficiently secreting and expressing various heterologous proteins in streptomyces.

Description

technical field [0001] The invention relates to the fields of molecular biology and genetic engineering, in particular to a Streptomyces secretion expression plasmid and its application in Streptomyces secretion and expression of foreign proteins. Background technique [0002] Streptomyces is a filamentous Gram-positive bacterium that can produce a large number of secondary metabolites, such as antibiotics and immunosuppressants, which are of great value in medicine and agricultural production. Streptomyces expression system is a new prokaryotic expression system developed in the middle and late 20th century. It has an efficient protein secretion mechanism, and the expressed protein is usually soluble and biologically active. These advantages make it a very useful Foreground expression system. [0003] The genome sequencing of the model bacterium Streptomyces coelicolor has been completed, and Streptomyces lividans has also become an expression host for efficient secretion ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/76C12N1/21C12P21/00C12R1/465
Inventor 洪斌朱元军王丽非杜郁余腾斐王松梅
Owner MEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com