New streptomyces secretion expression plasmid and application thereof
A Streptomyces and expression vector technology, applied in the fields of molecular biology and genetic engineering, can solve the problems of cumbersome operation, inconvenience and practicality, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1p
[0060] The construction process of embodiment 1 pIMB4
[0061] 1. Selection of expression vector Streptomyces replication region
[0062] Digest pSGL1 with SalI and SacI, recover a small fragment containing the smallest replicon, and connect it to pUC19-E [pUC19 (Kieser T, BibbMJ, Buttner MJ, Chater KF, Hopwood DA, which is also digested with SalI and SacI : Practical StreptomycesGenitics, 2000) the EcoR I site was artificially deleted] on the vector, to obtain plasmid pUC19-E / SG ( Figure 1A ).
[0063] 2. Acquisition of resistance genes, ori, the origin of replication in Escherichia coli, and ori T, an essential region for conjugative transfer in Streptomyces
[0064] The E. coli origin of replication ori and the ampicillin resistance gene bla are derived from the pBluescript II KS+ plasmid (Kieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA: Practical Streptomyces Genitics, 2000), essential regions for conjugative transfer in Streptomyces oriT and apramycin resistance...
Embodiment 2
[0085] Cloning and expression of embodiment 2IL6 in novel streptomyces expression vector pIMB3, pIMB4
[0086] 1 Construction of IL6 recombinant expression strain
[0087] According to the known human IL6 gene coding sequence, two primers IL6a and IL6b were designed,
[0088] IL6a: 5'TCCATATGGTACCCCCCAGGAGAAGATTC 3' (SEQ ID NO: 8)
[0089] IL6b: 5'CGGGATCCTTACATTTGCCGAAGAGCCTC 3' (SEQ ID NO: 9)
[0090] An Nde I restriction site was added to the 5' end of the upstream primer IL6a, a BamH I restriction site was added to the 5' end of the downstream primer IL6b, and a stop codon TAA was introduced before the restriction site. Pfu high-fidelity DNA polymerase was used for PCR, and the cDNA reverse-transcribed from the total RNA of human peripheral blood mononuclear cells was used as a template. The PCR amplification conditions were: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 1 minute, and annealing at 55°C 40 seconds, 72°C extension for 2 minutes, 30 cy...
Embodiment 3
[0102] Example 3 Purification and Biological Activity Verification of Recombinant Human IL6
[0103] 1. Prediction of physical and chemical properties and structure of IL6
[0104] Before purifying the protein, first conduct a preliminary analysis of the properties of the target protein, mainly including molecular weight and isoelectric point. We used the protein sequence analysis software package ANTHREPORT 5.0 to predict the physical and chemical properties of IL6 expressed in Example 2 S.lividans[pIMB4-IL6]. The molecular weight of the IL6 protein is 20813.87, and the isoelectric point pI=6.175; the entire molecule is hydrophobic and hydrophilic. The structure; the protein is completely soluble; no transmembrane structure.
[0105] 2. Isolation and purification of recombinant human IL6 expressed by Streptomyces
[0106] We choose strong cation exchange resin Q Sepharose Fast Flow as the separation medium, and the pH of the ion exchange starting buffer is more than 2 uni...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



