Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Deoxyribonucleic acid (DNA) aptamer for mycobacterium tuberculosis glycolipid antigen and application thereof

A technology of mycobacterium tuberculosis and aptamer, which is applied in the field of microbial immunity and inspection, and achieves the effect of high specificity, simple operation and low price

Inactive Publication Date: 2012-07-11
WUHAN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, so far, SELEX screening technology has not been successfully used to develop reagents for the diagnosis and treatment of Mycobacterium tuberculosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Deoxyribonucleic acid (DNA) aptamer for mycobacterium tuberculosis glycolipid antigen and application thereof
  • Deoxyribonucleic acid (DNA) aptamer for mycobacterium tuberculosis glycolipid antigen and application thereof
  • Deoxyribonucleic acid (DNA) aptamer for mycobacterium tuberculosis glycolipid antigen and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Screening of DNA Adapters

[0032] The present invention has the screening method of the DNA aptamer that specifically binds virulence Mycobacterium tuberculosis H37Rv as follows:

[0033] 1: Construct a random single-stranded DNA library and primers. Construction of a single-stranded DNA library with a length of 88 bases: 5'-GCG GAATTC TAATACGACTCACTATAGGGAACA GTCCGAGCC-N30-GGGTCAATGCGTCATA-3', where N stands for A, T, C, G four random bases. The upstream primer is: 5'- GCGGAATTCTAATACGACTCAC TATAGGGAACAGTCCGAGCC-3', the underlined part is Eco DNA restriction site for RI; downstream primer: 5’-GCG GGATCC TATGACGCATTG ACCC-3’, the underlined part is Bam DNA restriction enzyme site for HI. Random single-stranded DNA library and primers can be synthesized by the company.

[0034] 2. PCR amplification and storage of double-stranded DNA (dsDNA) and single-stranded DNA (ssDNA) libraries: Before each round of screening, the ssDNA library is amplified into ...

Embodiment 2

[0039] Example 2 Application of Ma1 in the diagnosis of tuberculosis

[0040] Using Ma1 as a template, aptamers labeled with biotin and fluorescent FAM were amplified by PCR, and then ELISA and flow cytometry were used to measure the binding ability with different bacteria.

[0041] ELISA method:

[0042] (1) First use different bacteria (1X10 5 / well) to coat a 96-well plate, then overnight at 4°C.

[0043] (2) Wash 6 times with PBS containing 0.05% Tween-20;

[0044] (3) Add 100 µL of PBS containing salmon sperm DNA (100 µg / mL) to each well for blocking, 37°C for ? hours;

[0045] (4) Wash 6 times with PBS containing 0.05% Tween-20;

[0046] (5) Add 100 μL of biotin-labeled Ma1 (40 pmol) to each well, 37°C for 1 hour;

[0047] (6) Wash 6 times with PBS containing 0.05% Tween-20;

[0048] (7) Add 100 μL of HRP-labeled streptavidin diluted 1:1000 to each well, at 37°C for 30 minutes;

[0049] (8) TMB develops color for 10-20 minutes, and terminates the reaction with 0.5...

Embodiment 3

[0065] Example 3 Inhibition of Ma1 to Mycobacterium tuberculosis

[0066] use 10 7 CFU (400μl) of H37Rv infected Balb / c mice. The mice were divided into two groups, 6 in each group. The mice in the first group were not treated after infection, and the mice in the second group were treated with aptamer Ma1 after infection. Each mouse was injected with 5 μg of aptamer on three days, once every three days, for a total of three injections. All mice were injected into the tail vein, and H37Rv was passaged in mice before the experiment to ensure sufficient virulence.

[0067] Confirmed by acid-fast staining ( Figure 5 ), the bacterial load in the lungs of mice infected with Mycobacterium tuberculosis H37Rv was significantly reduced after the action of the aptamer Ma1 compared with the mice in the non-adapter group, where A is the infection of virulent Mycobacterium tuberculosis H37Rv The acid-fast staining of the lungs of the mice, B is the acid-fast staining of the lungs of the m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a deoxyribonucleic acid (DNA) aptamer for mycobacterium tuberculosis glycolipid antigen, which has a nucleotide sequence shown as SEQ ID No. 1. Experiments show that the DNA aptamer disclosed by the invention has high specificity and strong appetency when acting with the mycobacterium tuberculosis, and a novel preparation is provided for the diagnosis of tuberculosis. Meanwhile, experiments show that the DNA aptamer can inhibit the infection of the mycobacterium tuberculosis, and a novel path is provided for the treatment of the tuberculosis.

Description

technical field [0001] The invention belongs to the field of microbial immunity and detection, and specifically relates to a single-stranded DNA aptamer capable of detecting human Mycobacterium Tuberculosis (H37Rv) [ATCC 93009 (4)]. The invention also relates to the application of the DNA aptamer in the early diagnosis and treatment of tuberculosis surface glycolipid antigen and tuberculosis. Background technique [0002] At present, tuberculosis is still one of the major infectious diseases threatening human life and health, and it is also one of the main factors leading to human death. According to WHO statistics, about one-third of the world's population is currently infected with tuberculosis, but has no obvious clinical manifestations. The resulting delay in diagnosis and misdiagnosis are the main reasons for the further spread of tuberculosis and the increase in mortality worldwide. At present, there are many defects in the existing diagnostic techniques for tubercul...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/115C12Q1/68A61K31/7088A61K48/00A61P31/06
Inventor 章晓联王其龙
Owner WUHAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com