Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Plutella xylostella cecropin gene, encoded protein, corresponding expression system and application

A technology of gene coding and cecropin, applied in the field of genetic engineering, to achieve the effect of strong inhibitory effect

Inactive Publication Date: 2011-06-15
SOUTH CHINA AGRI UNIV
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The antibacterial spectrum of antimicrobial peptides is wider than that of traditional antibiotics, which are usually only effective against bacteria, but not against pathogens such as fungi and viruses

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0081] Example 1 Cloning method of diamondback moth antimicrobial peptide Cecropin1 gene

[0082] Plutella xylostella ( Plutella xylostella ) larvae, with E. coli ( Escherichia coli ), Staphylococcus aureus ( Staphylococcus auceus ) and Aureobasidium pullulans ( Aureobasidium pullulans ) as the tested strain.

[0083] 1. Total RNA extraction: Stimulate the 4th instar larvae of Plutella xylostella with OD value of 0.8-1.0 Escherichia coli to induce antimicrobial peptides. Take 0.5-1 g of Plutella xylostella after 24 hours of induction, grind in liquid nitrogen, and extract total RNA with guanidine isothiocyanate method

[0084] 2. Synthesis of the first strand of cDNA: According to the instructions of the RACE kit of CLONTECH company, 10 μg of total RNA was added to 20 μl of reaction solution and reacted at 42°C for 90 minutes. The reaction was terminated at 72°C for 10 minutes. Reaction solution composition: 50 mmol KCl, 3 mmol MgCl, 10 mmol Tris-HCL pH8.3, 1 mmol D...

Embodiment 2

[0101] Example 2 The method for preparing cecropin from Plutella xylostella with bactericidal function

[0102] 1. Amplify the primers encoding the mature peptide of cecropin in Plutella xylostella:

[0103] PF: 5′-5′-GCG CCATGG AGCCGTTTAAAAAATTG GA -3′, ccatgg Indicates that the introduced enzyme cleavage site is NcoI,

[0104] PR: 5′-ggA ctcgag TCATTTGCCAGTAGGTCTGGCTA -3′, ctcgag Indicates that the introduced enzyme cleavage site is xho I.

[0105] 2. PCR amplification of cecropin mature peptide encoding from Plutella xylostella:

[0106] Using the cDNA of the 4th instar larvae of Plutella xylostella as a template, the reaction conditions are as follows:

[0107] Described mixed solution is composed as follows:

[0108] Contains 20 mM Mg 2+ 5 μl of 10× PCR buffer

[0109] Concentration of dATP, dTTP, dCTP, dGTP

[0110] 4 μl of 2.5 mM dNTP mix each

[0111] 4 μl of primer PR at a concentration of 10 μM

[0112] Primer PF 4 μl at a concentration...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a plutella xylostella cecropin gene, an encoded protein, a corresponding expression system and application. The plutella xylostella cecropin gene is double stranded linear deoxyribonucleic acid (DNA) with the length of 480bp, and a nucleotide sequence of the plutella xylostella cecropin gene is shown in SEQ ID NO:1. The protein encoded by the gene has 65 amino acids, and an amino acid sequence of the protein is shown in SEQ ID NO:2. Plutella xylostella cecropin is expressed in Escherichia coli through a gene recombination technology, and the plutella xylostella cecropin with an antibacterial function is obtained. The plutella xylostella cecropin with the antibacterial function has broad application value in medicines, food preservation or adding of feed preservatives.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a diamondback moth cecropin gene, encoded protein, corresponding expression system and application. Background technique [0002] Antimicrobial peptides are a new type of anti-infective peptides that are not easy to cause microbial drug resistance. The first antimicrobial peptide found in the world is cecropins. In 1980, Swedish scientist Boman et al. induced the chrysalis of Cecropin chrysalis to produce antibacterial polypeptide substances, which were named cecropins. Cecropin is the first discovered insect antimicrobial peptide, which widely exists in insects, and now more than 20 cecropin analogues have been isolated and purified from Lepidoptera moths, butterflies and Diptera flies. Later, a variety of bacteriopeptides were found in other organisms, such as magainins, melittins, and defensins. At present, there are more than 1200 kinds of antimicrobial peptides...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C07K14/435A23K1/00A23K1/18A23L3/3526A23K30/00A23K50/00
Inventor 金丰良任顺祥许小霞
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com