Plutella xylostella cecropin gene, encoded protein, corresponding expression system and application
A technology of gene coding and cecropin, applied in the field of genetic engineering, to achieve the effect of strong inhibitory effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0081] Example 1 Cloning method of diamondback moth antimicrobial peptide Cecropin1 gene
[0082] Plutella xylostella ( Plutella xylostella ) larvae, with E. coli ( Escherichia coli ), Staphylococcus aureus ( Staphylococcus auceus ) and Aureobasidium pullulans ( Aureobasidium pullulans ) as the tested strain.
[0083] 1. Total RNA extraction: Stimulate the 4th instar larvae of Plutella xylostella with OD value of 0.8-1.0 Escherichia coli to induce antimicrobial peptides. Take 0.5-1 g of Plutella xylostella after 24 hours of induction, grind in liquid nitrogen, and extract total RNA with guanidine isothiocyanate method
[0084] 2. Synthesis of the first strand of cDNA: According to the instructions of the RACE kit of CLONTECH company, 10 μg of total RNA was added to 20 μl of reaction solution and reacted at 42°C for 90 minutes. The reaction was terminated at 72°C for 10 minutes. Reaction solution composition: 50 mmol KCl, 3 mmol MgCl, 10 mmol Tris-HCL pH8.3, 1 mmol D...
Embodiment 2
[0101] Example 2 The method for preparing cecropin from Plutella xylostella with bactericidal function
[0102] 1. Amplify the primers encoding the mature peptide of cecropin in Plutella xylostella:
[0103] PF: 5′-5′-GCG CCATGG AGCCGTTTAAAAAATTG GA -3′, ccatgg Indicates that the introduced enzyme cleavage site is NcoI,
[0104] PR: 5′-ggA ctcgag TCATTTGCCAGTAGGTCTGGCTA -3′, ctcgag Indicates that the introduced enzyme cleavage site is xho I.
[0105] 2. PCR amplification of cecropin mature peptide encoding from Plutella xylostella:
[0106] Using the cDNA of the 4th instar larvae of Plutella xylostella as a template, the reaction conditions are as follows:
[0107] Described mixed solution is composed as follows:
[0108] Contains 20 mM Mg 2+ 5 μl of 10× PCR buffer
[0109] Concentration of dATP, dTTP, dCTP, dGTP
[0110] 4 μl of 2.5 mM dNTP mix each
[0111] 4 μl of primer PR at a concentration of 10 μM
[0112] Primer PF 4 μl at a concentration...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap