mRNA in-situ hybridization kit for detecting overexpression of her2
A detection kit and in-situ hybridization technology, which is applied in the field of RNA in-situ hybridization detection kits to achieve the effects of overcoming tissue endogenous biotin interference, enhancing specificity and preventing competitive hybridization
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1: Primer design and probe synthesis
[0042] Design specific primers for RT-PCR according to the nucleotide sequence of HER2 gene (NO.M11730), the sequence is as follows:
[0043] The HER2 forward primer sequence is: GATGCCCAACCAGGCGCAGAT 21bp;
[0044] The sequence of the HER2 reverse primer is: ACCAGCTGCACCGTGGATGTCAG 23bp.
[0045] Using the human blood RNA extracted by the Trizol method as a template for RT-PCR amplification, the probe-specific fragments are obtained, as shown in the figure: the electrophoresis diagram of the HER2 probe fragment amplified by RT-PCR; the specificity obtained by RT-PCR amplification The sequence is as follows:
[0046] GATGCCCAACCAGGCGCAGATGCGGATCCTGAAAGAGACGGAGCTGAGGAAGGTGAAGGTGCTTGGATCTGGCGCTTTTGGCACAGTCTACAAGGGCATCTGGATCCCTGATGGGGAGAATGTGAAAATTCCAGTGGCCATCAAAGTGTTGAGGGAAAACACATCCCCCAAAGCCAACAAAGTCGTGCGTGCGTGAAGGTGCTTGGATCTGGCGGTGCGTGCAGTCTACAAGGGCATCTGGATCCCTGATGGGGAGAATGTGAAAATTCCAGTGGCCATCAAAGTGTTGAGGGAAAACACATCCCCCAAAGCTGGCGCTGG...
Embodiment 2
[0056] Example 2: Reagent preparation
[0057] 1. The fixative solution is 4% paraformaldehyde (pH 7.4) prepared in RNase-free PBS.
[0058] 2. PBS-Buffer I is made of 140mmol / LNaCl, 2.7mmolKCl, 10mmol / LNa treated with DEPC 2 HPO 4 And 1.8mmol / L KH 2 PO 4 Composition of pH7.4 buffer.
[0059] 3. PBS-Buffer II PBS-Buffer I containing 100mmol / L glycine.
[0060] 4. PBS-Buffer III PBS-Buffer I containing 0.3% TritonX-100.
[0061] 5. Digestion solution A 20μg / ml proteinase K solution without RNase prepared by TE buffer (100mmol / L Tris-HCl, 50mmol / LEDTA, pH8.0).
[0062] 6. The pre-hybridization solution is a solution composed of 50% deionized formamide, 20×SSC, 50×Denhardt, and 0.1 mg / ml tRNA.
[0063] 7. Washing Buffer I is a solution containing 300mol / L NaCl and 30mol / L sodium citrate (pH7.0).
[0064] 8. Washing Buffer II is a solution containing 150mmol / L NaCl and 15mmol / L sodium citrate (pH7.0).
[0065] 9. Buffer I is a solution containing 100 mmol / L Tris-HCl and 150 mmol / L NaCl (pH 7.5)...
Embodiment 3
[0071] Example 3: Use of the kit
[0072] 1. Tissue section processing
[0073] 1) Dewaxing xylene at 37℃ twice, 15 minutes each time;
[0074] 2) Soak in absolute ethanol twice, 3 minutes each time;
[0075] 3) Soak in 95% ethanol twice, 3 minutes each time;
[0076] 4) Wash with PBS-Buffer I twice, 3 minutes each time;
[0077] 5) Wash twice with PBS-Buffer II, 3 minutes each time;
[0078] 6) Add digestion solution and incubate at 37°C for 20 minutes;
[0079] 7) Wash twice with PBS-BufferIII, 5 minutes each time;
[0080] 8) Fixing solution treatment for 10 minutes;
[0081] 9) Wash twice with PBS-Buffer I, 5 minutes each time;
[0082] 2. Pre-hybrid
[0083] Add pre-hybridization solution and incubate at 50°C for 1 hour;
[0084] 3. Hybrid
[0085] Add hybridization solution and incubate overnight at 50°C.
[0086] 4. Elution
[0087] 1) Washing Buffer I wash 2 times, 15 minutes each time;
[0088] 2) Washing Buffer II twice, 15 minutes each time;
[0089] 3) Buffer I treatment 2 times, 5 minut...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com