Unlock instant, AI-driven research and patent intelligence for your innovation.

Bacillus anthracis detection kit and using method of kit

A technology of Bacillus anthracis and detection kit, which is applied in the directions of biochemical equipment and methods, determination/inspection of microorganisms, etc., can solve the problems of easy cross-contamination operation process, increasing the difficulty of popularization and application, complex quantitative determination instruments, etc., Achieving fast and efficient amplification, reducing the possibility of aerosol contamination, and easy identification

Active Publication Date: 2011-08-10
GUANGZHOU HUAFENG BIOTECH +1
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003]The traditional Bacillus anthracis detection method is far from meeting the requirements of modern detection due to its shortcomings such as long detection cycle, complicated procedures, and various reagents required
The pathogenic nucleic acid detection technology represented by polymerase chain reaction (PCR) technology has some problems in practical application, such as ordinary polymerase chain reaction (PCR) technology requires special instruments, and there are easy cross-contamination and cumbersome operation process Shortcomings
Although the fluorescent real-time quantitative polymerase chain reaction (real time PCR) technology has better solved the problem of cross-contamination and simplified the operation process, it requires more complex quantitative measurement instruments, so it is not suitable for on-site rapid detection
Moreover, the cost of fluorescent probes in real-time quantitative polymerase chain reaction PCR technology is relatively high, which increases the difficulty of popularization and application.
Immunological detection technology is fast, simple and low-cost, but requires high-quality and high-stability monoclonal antibodies. Otherwise, due to insufficient accuracy, it can only be used as an auxiliary detection method at present.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus anthracis detection kit and using method of kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] The preparation of embodiment 1 kit

[0065] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0066] Outer primer F3:

[0067] CTGATAGTCAAACGAGAACAA

[0068] Outer primer B3:

[0069] AGTTTCTTTCCCCTGCTAGA

[0070] Inner primer FIP:

[0071] CGCATGCACTTCTGCATTTCTTTTAATACTTCTACAAGTAGGACACAT

[0072] Inner primer BIP:

[0073] TCGTTCTTTGATATTGGTGGGAGTTTTTTGATAGTGAATGATCAATTGCGAC.

[0074] (2) Purchasing DNA polymerase: Bst DNA polymerase is placed in the container;

[0075] (3) Prepare reaction solution and primers: the reaction solution contains 2mmol / LdNTP, 25mmol / L Tris-Cl, 12.5mmol / L KCl, 12.5mmol / L (NH 4 ) 2 SO 4 , 10mmol / L MgSO 4 , 0.125% by volume TritonX-100, 1mol / L betaine, each 0.2 μmol / L of inner primer FIP / BIP and each 0.25 μmol / L of outer primer F3 / B3 are placed in the container;

[0076] (4) Prepare the sample pretreatment solution: the sample pretreatment solution contains 20 mmol / L Tris-H...

Embodiment 2

[0087] Example 2 Application of Bacillus anthracis Detection Kit

[0088] 1 Materials and methods

[0089] 1.1 Materials

[0090] 1.1.1 Strains

[0091] The present invention adopts 16 bacterial strains, which are mainly derived from the Academy of Military Medical Sciences, clinical isolated bacterial strains and environmental isolated bacterial strains. See Table 1 for details.

[0092] strain source

Strain and serial number

Military Medical Academy

Bacillus anthracis

Clinical isolates

Derived from 5 strains of Bacillus anthracis in the test sample;

other strains

2 strains of Bacillus subtilis, 2 strains of Bacillus cereus, 2 strains of Bacillus thuringiensis, 2 strains of Bacillus brown nigeri, 1 strain of Brucella, and 1 strain of Yersinia pestis.

[0093] 1.1.2 Main instruments and reagents

[0094] 1.2 Identification of isolated strains

[0095] 1.2.1 Cultivation of Bacillus anthracis Bacillus anthracis puncture-c...

Embodiment 3

[0122] Example 3 Bacillus anthracis detection kit using reaction tube

[0123] The Bacillus anthracis detection kit of this embodiment uses the same reagents and primers as in Example 1. The kit also includes a reaction tube, which is composed of a tube body and a tube cover. The lower part of the inner cavity of the tube is provided with a A vertically extending partition that separates two cavities A and B, wherein: Cavity A is filled with 22.0 μL of LAMP reaction solution and 0.5 μL of Bst For DNA polymerase, the upper layer of the liquid is sealed with paraffin; cavity B is filled with 2.0 μL of LAMP reaction chromogenic solution, and the upper layer of the liquid is also sealed with paraffin, and the reaction tube is stored at -20°C.

[0124] In this embodiment, a reaction tube is used as a container to carry out LAMP detection on Bacillus anthracis, and a positive control group and a negative control group are provided at the same time, which specifically includes the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a bacillus anthracis detection kit. The bacillus anthracis detection kit comprises two pairs of primers using bacillus anthracis PA genes as target genes and designed on the basis of a loop-mediated isothermal amplification technology, namely inner primers FIP / BIP and outer primers F3 / B3. The bacillus anthracis detection kit has more comprehensive detection effect and low omission rate.

Description

technical field [0001] The invention relates to a biological detection reagent, in particular to a Bacillus anthracis detection kit and a use method thereof. Background technique [0002] Bacillus anthracis belongs to the genus of aerobic bacillus, which can cause anthrax in sheep, cattle, horses and other animals and humans, and can cause extensive environmental pollution. Due to the strong resistance of anthrax spores to the external environment, this pollution often persists. Therefore, it is of great significance to detect Bacillus anthracis accurately and rapidly. [0003] The traditional Bacillus anthracis detection method is far from meeting the requirements of modern detection due to its shortcomings such as long detection cycle, complicated procedures, and various reagents required. The pathogenic nucleic acid detection technology represented by polymerase chain reaction (PCR) technology has some problems in practical application, such as ordinary polymerase chain...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04
Inventor 田桢干陆晔何宇平王传现张继伦周蕾曹以诚杜正平陈洵谭慧媚
Owner GUANGZHOU HUAFENG BIOTECH