Method for obtaining strain capable of expressing lipase effectively

A high-efficiency expression and lipase technology, applied in the field of genetic engineering, can solve problems such as unclear, unclear and limited

Active Publication Date: 2011-08-17
ANHUI LEVEKING BIOTECH CO LTD
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the traditional strain breeding method mainly relies on random physical and chemical mutagenesis, which has unclear goals, is time-consuming and laborious, and has no obvious results. At present, the use of these methods to improve the ability of the strain to produce lipase has been very limited and has little potential.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for obtaining strain capable of expressing lipase effectively
  • Method for obtaining strain capable of expressing lipase effectively
  • Method for obtaining strain capable of expressing lipase effectively

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Embodiment 1, the construction of overexpression vector

[0064] Take the following steps:

[0065] (1) utilize restriction endonuclease Sac I, Kpn I to hygromycin resistance expression cassette from plasmid PV2 + Enzymatic cleavage (such as figure 1 shown), the fragment was recovered by gel, and cloned into the pCAMBIA2300 plasmid (such as figure 2 Shown), the recombinant plasmid pCHAMBIA2302 with hygromycin resistance was obtained (such as image 3 shown); the hygromycin expression cassette can also be derived from any other DNA containing this sequence or directly synthesized, and the plasmid used to construct the PEL gene overexpression vector can also be expressed in filamentous fungi such as pCAMBIA1300 except for pCAMBIA2300 , pCAMBIA3300 and other pCAMBIA series vectors and pHB vectors;

[0066] (2) According to the sequence design primer (forward primer: TG) of the lipase gene PEL (AF330635) of Penicillium expanded ACTAGT ATGTTGTTCAACTACCAATCTTT The und...

Embodiment 2

[0073] Embodiment two, the acquisition of Penicillium genetically engineered bacteria

[0074] The activity of described Penicillium genetically engineered bacterium comprises the steps:

[0075] (1) Pick the isolated and purified wild-type Penicillium and inoculate it on a PDA plate, cultivate it at 28°C for about 20 days, and wash the mature spores with sterile water;

[0076] (2) Inoculate the engineered Agrobacterium EHA105 containing the final vector pCHAMBIA2302::PgpdA-PEL-TtrpC in Example 1 in the LB liquid medium containing streptomycin and kanamycin (both 100 μg / ml) at 28°C, Cultivate overnight at 200 rpm, reactivate with MM medium containing streptomycin and kanamycin (both 100 μg / ml), and culture at 220 rpm for 48 hours at 28°C. Take an appropriate amount of culture and centrifuge at 5000rpm to remove the supernatant, wash with 1M liquid medium, and finally dilute to OD600=0.15 with 1M liquid medium, then cultivate at 28°C and 220rpm for 6-8 hours until OD600=0.5- ...

Embodiment 3

[0084] Embodiment 3, comparative experiment of producing lipase ability

[0085] Randomly select the Penicillium genetically engineered bacterium that example 2 gained is inoculated on the PDA medium, insert in the seed culture medium 50mL respectively after cultivating 10 days, at 28 ℃, 210rpm shaker culture 24h, then transfer to respectively with 10% inoculum amount Fermentation medium (30mL fermentation medium in 250mL Erlenmeyer flask) was fermented at 28°C and 210rpm for 48h; then the fermentation broth was centrifuged, and the supernatant was taken for lipase activity detection.

[0086] The lipase activity was detected by acid-base titration.

[0087] step:

[0088] Take 20 100mL Erlenmeyer flasks, add 4.0mL Gly-NaOH buffer solution with pH 9.4 and 5.0mL olive oil emulsion respectively; put them into a oscillating constant temperature water bath at 36°C to preheat for 5 minutes. After filtering the enzyme solution, use 0.05 mol / L Gly-NaOH buffer solution with pH9.4 wa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Aiming at the drawbacks of the prior art, the invention applies for providing a method for breeding a penicillium gene engineering bacterium having high lipase synthesis capability. The method comprises: obtaining a hygromycin-resistance expression box and cloning to a target plasmid to obtain a hygromycin-resistance plasmid; amplifying the lipase gene, namely primary effusion lymphoma (PEL), of the penicillium and the strong promoter, namely glyceraldehyde-3-phosphate dehydrogenase promoter PgpdA, of Aspergillus nidulans and tryptophan synthetase terminator TtrpC of the Aspergillus nidulans respectively to obtain a PEL gene expression box driven by the strong promoter; inserting the PEL gene expression box into the hygromycin-resistance plasmid to obtain a PEL gene super expression vector containing a hygromycin screening marker; and finally, transferring Agrobacterium rhizogenes by using the PEL gene super expression vector containing the hygromycin screening marker, and transferring the PEL gene expression box into a penicillium strain by using a Agrobacterium rhizogenes-mediated transfer method to obtain the penicillium gene engineering bacterium with high lipase expressing capability.

Description

technical field [0001] The application of the present invention relates to a method for improving the lipase-producing ability of Penicillium strains, specifically a method for using the Aspergillus nidulans 3-phosphate glyceraldehyde dehydrogenase promoter (gpdA) to drive the high-efficiency expression of the endogenous lipase gene of Penicillium penicillium The method belongs to the technical field of genetic engineering. Background technique [0002] In recent years, lipase (Lipase EC) has made great progress in industrial application. Alkaline lipase has the advantages of high substrate hydrolysis efficiency, mild reaction, non-toxicity, and ability to hydrolyze fat under certain conditions. It has been used in washing It has been widely used in the fields of pharmaceuticals, papermaking, tanning, food, textile and light industry, and has become an important variety in the global enzyme preparation market. [0003] Through the selection and breeding of a large number of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/55C12N15/63C12N1/15C12R1/80
CPCC12N9/20A61K38/465A61P3/06
Inventor王剑英唐可轩张田林智王节亮
OwnerANHUI LEVEKING BIOTECH CO LTD