Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for detecting target genes in plants and special SPR biosensor thereof

A biosensor and target gene technology, applied in a method for detecting target genes in plants and its special SPR biosensor field, can solve the problems of biodiversity destruction, insect resistance enhancement, and reduction of natural enemies, and achieve high Sensitivity, easy-to-operate effects

Inactive Publication Date: 2011-09-14
INST OF BOTANY CHINESE ACAD OF SCI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Example: The planting area of ​​Bt transgenic insect-resistant cotton in my country is increasing year by year. According to statistics, 90% of the cotton planted in Hebei Province this year are insect-resistant cotton varieties. However, insect-resistant cotton may cause some problems like other genetically modified crops. , such as the enhancement of insect resistance, the reduction of natural enemies, gene drift, the destruction of biodiversity, etc., the realization of long-term monitoring of Bt transgenic insect-resistant cotton is the current research trend

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting target genes in plants and special SPR biosensor thereof
  • Method for detecting target genes in plants and special SPR biosensor thereof
  • Method for detecting target genes in plants and special SPR biosensor thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Embodiment 1, preparation and verification of SPR biosensor

[0064] The principle of SPR detection of the coding gene Cry1Ac of Bt protein: use BIAcore3000 (GE Company) designed based on the principle of surface plasmon resonance (SPR) to detect whether the sample contains Cry1Ac gene, the chip selected is SA chip, which is characterized in carboxylation The surface of the dextran is covered with a layer of streptavidin, which is very suitable for capturing biotin-labeled DNA fragments, so when designing probes, biotin can be labeled at its 5' end. Due to the high affinity between streptavidin and biotin, when the probe flows into the chip surface, it will be bound to the chip surface as a ligand (ligand), and the sample will flow through the chip surface at a constant flow rate and concentration, if The analyte (analyte) in the sample and the ligand coupled on the chip will undergo base pairing, the mass of the chip surface substance will change, and the instrument wi...

Embodiment 2

[0103] Embodiment 2, SPR biosensor detection target gene

[0104] 1. Sample preparation

[0105] The above experiments discussed the issues that need to be paid attention to in SPR detection from various aspects, and provided a basis for the subsequent detection of transgenic genes.

[0106] In the experiment, the genomes of wild-type cotton DP5415 and transgenic cotton Nucotn33B were extracted using a plant genome rapid extraction kit (Novascience, Dg05020). Using them as templates, PCR amplification was performed with primers BtFW1 and BtRV1 respectively; Product and PCR product of transgenic cotton Nucotn33B.

[0107] In addition, in order to analyze whether the chip has specificity in detecting PCR products, a negative control was designed, that is, using primers BtFW2 and BtRV2 (BtFW2: 5'CGGTTACACTCCCATCGACATCTCC 3'; BtRV2: 5'TTGAATTGAATACGCATTTCCTCGC 3') to transgenic cotton Nucotn33B genome PCR amplification was performed as a template to obtain a control PCR product....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting target genes in plants and a special surface plasmon resonance (SPR) biosensor thereof. The method comprises the following steps of: 1) extracting deoxyribonucleic acids (DNA) of genomes of biont to be detected as templates, and performing polymerase chain reaction (PCR) amplification by taking primer pairs in the following reagents as primers to obtain PCR products; 2) modifying the PCR products obtained in the step 1) into single-stranded DNA molecules; and 3) allowing solution of the obtained single-stranded DNA molecules to flow through the SPR biosensor, and if the detected response values (RU) are changed, determining that the plants to be detected contain the target genes, or if the RU values are not changed, determining that the plants to be detected do not contain the target genes. Experiments prove that the SPR biosensor enveloped with a probe is constructed and is used for detecting whether genetic cotton contains a CrylAc gene or not, so the SPR biosensor has the advantages of high sensitivity and flux and automation and is easy to operate.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for detecting target genes in plants and a special SPR biosensor thereof. Background technique [0002] Surface plasmon resonance (SPR) biosensor is a rapidly developed optical biochemical detection technology in the world in recent years. The SPR biosensor is to immobilize probes or ligands on the surface of the gold film of the sensor chip to form a monomolecular layer. When the liquid containing the analyte that can interact with it flows through the surface of the sensor chip, specific binding occurs between the molecules and can be detected. The change of the refractive index on the surface of the sensing sheet is caused, and the interaction between molecules is monitored by detecting the change of the SPR signal. SPR biosensor has the characteristics of label-free, sensitive, accurate, fast, continuous online and high-throughput detection, and is especially suitable f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 麻密赵卓亚徐文忠何振艳陈焱山
Owner INST OF BOTANY CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com